Incidental Mutation 'R7018:Peg3'
ID 545448
Institutional Source Beutler Lab
Gene Symbol Peg3
Ensembl Gene ENSMUSG00000002265
Gene Name paternally expressed 3
Synonyms Zfp102, Gcap4, Pw1, End4
MMRRC Submission
Accession Numbers

Genbank: NM_008817; MGI: 104748

Essential gene? Non essential (E-score: 0.000) question?
Stock # R7018 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 6703892-6730431 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6708839 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1128 (E1128G)
Ref Sequence ENSEMBL: ENSMUSP00000050750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051209] [ENSMUST00000143703] [ENSMUST00000150182]
AlphaFold Q3URU2
Predicted Effect possibly damaging
Transcript: ENSMUST00000051209
AA Change: E1128G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000050750
Gene: ENSMUSG00000002265
AA Change: E1128G

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 213 221 N/A INTRINSIC
ZnF_C2H2 325 347 7.26e-3 SMART
ZnF_C2H2 378 400 6.88e-4 SMART
ZnF_C2H2 436 458 2.95e-3 SMART
low complexity region 464 496 N/A INTRINSIC
ZnF_C2H2 520 542 5.99e-4 SMART
low complexity region 691 698 N/A INTRINSIC
ZnF_C2H2 850 872 2.99e-4 SMART
ZnF_C2H2 1091 1113 2.05e-2 SMART
ZnF_C2H2 1147 1169 1.04e-3 SMART
ZnF_C2H2 1209 1231 1.38e-3 SMART
ZnF_C2H2 1266 1289 1.89e-1 SMART
ZnF_C2H2 1317 1339 1.57e2 SMART
low complexity region 1373 1419 N/A INTRINSIC
low complexity region 1440 1486 N/A INTRINSIC
ZnF_C2H2 1488 1510 2.2e-2 SMART
ZnF_C2H2 1547 1569 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143703
SMART Domains Protein: ENSMUSP00000122423
Gene: ENSMUSG00000002265

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150182
SMART Domains Protein: ENSMUSP00000116161
Gene: ENSMUSG00000002265

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, ZIM2 and PEG3 are treated as two distinct genes though they share multiple 5' exons and a common promoter and both genes are paternally expressed (PMID:15203203). Alternative splicing events connect their shared 5' exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. In contrast, in other mammals ZIM2 does not undergo imprinting and, in mouse, cow, and likely other mammals as well, the ZIM2 and PEG3 genes do not share exons. Human PEG3 protein belongs to the Kruppel C2H2-type zinc finger protein family. PEG3 may play a role in cell proliferation and p53-mediated apoptosis. PEG3 has also shown tumor suppressor activity and tumorigenesis in glioma and ovarian cells. Alternative splicing of this PEG3 gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2009]
PHENOTYPE: Heterozygous mutant females exhibit growth retardation, impaired maternal behavior and diminished milk ejection, and fewer oxytocin neurons. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 62,937,049 R129L probably damaging Het
Arhgef28 C T 13: 97,965,435 V844I probably damaging Het
Arhgef5 T C 6: 43,288,731 V1569A probably damaging Het
Atr T A 9: 95,866,694 S431T probably benign Het
Cdh11 T C 8: 102,634,321 D795G possibly damaging Het
Crygf T C 1: 65,927,971 S85P probably benign Het
Diexf A G 1: 193,114,855 I563T probably benign Het
Dip2c T A 13: 9,659,278 Y1385N probably damaging Het
Dnah14 G A 1: 181,626,944 V840I possibly damaging Het
Dsg1a T C 18: 20,328,738 F299L possibly damaging Het
Fgfr4 A T 13: 55,166,200 S576C probably damaging Het
Frmd8 T C 19: 5,869,518 D167G probably damaging Het
Gm5105 G A 3: 138,049,558 T89I unknown Het
Grhl1 C T 12: 24,575,997 S35L possibly damaging Het
Gsn A G 2: 35,293,506 E242G probably benign Het
Hcrtr1 A G 4: 130,135,868 I140T probably damaging Het
Ifnlr1 T C 4: 135,703,824 Y208H possibly damaging Het
Ighv1-58 T C 12: 115,312,365 Y51C probably damaging Het
Iqcj T A 3: 68,041,247 Y21* probably null Het
Kcnc4 T C 3: 107,458,862 Y10C probably benign Het
Kcnk7 G T 19: 5,706,132 G129W probably damaging Het
Kcnq2 T A 2: 181,081,724 R620* probably null Het
Klk13 C A 7: 43,726,702 P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
L3mbtl4 G A 17: 68,486,943 R314H probably damaging Het
Lamc2 T A 1: 153,136,742 M729L probably benign Het
Lyst T G 13: 13,743,459 probably null Het
Med13l G A 5: 118,751,986 R1909H probably damaging Het
Mstn T A 1: 53,064,084 L193Q possibly damaging Het
Mylk T C 16: 35,000,426 V125A possibly damaging Het
Nalcn T A 14: 123,409,821 M547L probably damaging Het
Nckap5 A G 1: 126,025,048 S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 Y189C probably damaging Het
Olfr1164 T A 2: 88,093,256 I227F probably benign Het
Olfr193 A G 16: 59,110,607 M1T probably null Het
Olfr490 T G 7: 108,286,344 I261L probably benign Het
Olfr761 A T 17: 37,952,502 I174N probably damaging Het
Oosp3 T A 19: 11,699,419 D47E probably benign Het
Pcdh15 G T 10: 74,466,354 G942W probably damaging Het
Pcyox1l C A 18: 61,707,554 probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plscr1 T A 9: 92,264,662 V119D probably damaging Het
Prss56 A T 1: 87,185,948 D258V possibly damaging Het
Ptpn23 T G 9: 110,385,816 K85Q possibly damaging Het
Ranbp3l C A 15: 9,007,285 S7Y probably benign Het
Rnf31 T C 14: 55,592,233 L85P probably damaging Het
Rptn T C 3: 93,397,900 C847R possibly damaging Het
Six4 T A 12: 73,108,953 E413D probably benign Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Sned1 T C 1: 93,284,421 V1115A probably damaging Het
Spen T C 4: 141,493,444 K401E unknown Het
Srbd1 T A 17: 86,136,415 R128W possibly damaging Het
Strc A T 2: 121,369,058 I1300N probably damaging Het
Susd1 T G 4: 59,390,627 T230P probably benign Het
Thumpd2 G T 17: 81,055,897 S47* probably null Het
Tmprss11a C T 5: 86,428,570 V141I probably damaging Het
Tmprss15 T C 16: 79,024,853 Y438C possibly damaging Het
Tnfrsf1a T C 6: 125,356,951 S56P probably damaging Het
Ttc39d T C 17: 80,216,181 W90R probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20rt A T 12: 65,225,762 probably null Het
Zfp646 C A 7: 127,882,322 Q1224K probably benign Het
Other mutations in Peg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Peg3 APN 7 6710274 missense probably benign 0.09
IGL01410:Peg3 APN 7 6707625 missense probably benign 0.04
IGL01415:Peg3 APN 7 6711653 missense probably damaging 0.99
IGL02073:Peg3 APN 7 6711002 missense probably damaging 1.00
IGL02193:Peg3 APN 7 6711928 missense probably damaging 1.00
IGL02212:Peg3 APN 7 6711416 missense probably benign 0.41
IGL02215:Peg3 APN 7 6709011 missense probably benign 0.00
IGL02407:Peg3 APN 7 6707636 missense probably damaging 0.99
IGL02586:Peg3 APN 7 6710069 missense probably benign
IGL02673:Peg3 APN 7 6710414 missense probably damaging 1.00
IGL02935:Peg3 APN 7 6711129 missense probably damaging 1.00
IGL03277:Peg3 APN 7 6711674 missense probably damaging 1.00
IGL03330:Peg3 APN 7 6710413 missense probably damaging 1.00
IGL03393:Peg3 APN 7 6707649 missense probably damaging 0.99
R0049:Peg3 UTSW 7 6711673 missense possibly damaging 0.85
R0049:Peg3 UTSW 7 6711673 missense possibly damaging 0.85
R0518:Peg3 UTSW 7 6711428 missense probably damaging 1.00
R0521:Peg3 UTSW 7 6711428 missense probably damaging 1.00
R1477:Peg3 UTSW 7 6716142 missense probably damaging 1.00
R1716:Peg3 UTSW 7 6707781 missense possibly damaging 0.93
R1721:Peg3 UTSW 7 6709901 missense possibly damaging 0.92
R1732:Peg3 UTSW 7 6709085 missense possibly damaging 0.72
R2051:Peg3 UTSW 7 6712721 missense probably damaging 0.96
R2288:Peg3 UTSW 7 6709115 missense probably damaging 0.96
R3606:Peg3 UTSW 7 6708509 missense probably damaging 1.00
R5075:Peg3 UTSW 7 6708420 missense probably damaging 1.00
R5076:Peg3 UTSW 7 6708420 missense probably damaging 1.00
R5084:Peg3 UTSW 7 6707849 missense probably damaging 1.00
R5097:Peg3 UTSW 7 6710027 missense probably damaging 0.99
R5121:Peg3 UTSW 7 6710289 missense probably benign 0.20
R5141:Peg3 UTSW 7 6709382 missense probably benign 0.03
R5292:Peg3 UTSW 7 6708260 missense probably damaging 1.00
R5294:Peg3 UTSW 7 6717849 missense possibly damaging 0.88
R5342:Peg3 UTSW 7 6709970 missense probably damaging 1.00
R5415:Peg3 UTSW 7 6708629 missense probably benign
R5906:Peg3 UTSW 7 6717855 missense probably damaging 0.99
R6056:Peg3 UTSW 7 6709571 missense probably damaging 1.00
R6259:Peg3 UTSW 7 6709811 missense probably damaging 0.99
R6529:Peg3 UTSW 7 6708072 missense probably damaging 1.00
R6631:Peg3 UTSW 7 6709070 missense possibly damaging 0.72
R6855:Peg3 UTSW 7 6708798 missense probably benign 0.13
R6861:Peg3 UTSW 7 6711386 nonsense probably null
R6864:Peg3 UTSW 7 6712762 missense probably damaging 1.00
R6892:Peg3 UTSW 7 6708899 missense possibly damaging 0.58
R7039:Peg3 UTSW 7 6717859 missense probably damaging 0.99
R7066:Peg3 UTSW 7 6708857 missense probably damaging 1.00
R7117:Peg3 UTSW 7 6709168 unclassified probably benign
R7133:Peg3 UTSW 7 6708945 missense probably damaging 1.00
R7493:Peg3 UTSW 7 6709724 missense probably damaging 1.00
R7539:Peg3 UTSW 7 6708168 missense probably benign 0.00
R7642:Peg3 UTSW 7 6709168 unclassified probably benign
R7646:Peg3 UTSW 7 6709222 missense probably benign
R7658:Peg3 UTSW 7 6709610 missense probably damaging 1.00
R7846:Peg3 UTSW 7 6710651 missense probably damaging 1.00
R7853:Peg3 UTSW 7 6708840 missense possibly damaging 0.72
R7903:Peg3 UTSW 7 6709168 unclassified probably benign
R7913:Peg3 UTSW 7 6709168 unclassified probably benign
R7948:Peg3 UTSW 7 6708782 missense probably damaging 1.00
R8219:Peg3 UTSW 7 6708365 missense probably benign 0.00
R8385:Peg3 UTSW 7 6708083 missense probably damaging 1.00
R8672:Peg3 UTSW 7 6708524 missense possibly damaging 0.62
R9133:Peg3 UTSW 7 6709168 unclassified probably benign
R9209:Peg3 UTSW 7 6708227 missense possibly damaging 0.48
R9457:Peg3 UTSW 7 6707999 missense probably damaging 0.99
R9518:Peg3 UTSW 7 6711281 missense probably benign 0.00
R9519:Peg3 UTSW 7 6711395 missense probably benign 0.00
R9599:Peg3 UTSW 7 6711724 missense probably damaging 0.97
RF039:Peg3 UTSW 7 6709168 unclassified probably benign
YA93:Peg3 UTSW 7 6711647 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGATTCCTTTCAACAGTGC -3'
(R):5'- AAGATGCTACCATTCAGGCC -3'

Sequencing Primer
(F):5'- TTGGTCTCACGGGCAACAGAG -3'
(R):5'- GCCTCAGTTTCTGAAGAGCATCAG -3'
Posted On 2019-05-13