Incidental Mutation 'R7018:Zfp646'
ID 545451
Institutional Source Beutler Lab
Gene Symbol Zfp646
Ensembl Gene ENSMUSG00000049739
Gene Name zinc finger protein 646
Synonyms
MMRRC Submission 045119-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.251) question?
Stock # R7018 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 127476081-127485168 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 127481494 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 1224 (Q1224K)
Ref Sequence ENSEMBL: ENSMUSP00000052641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050383] [ENSMUST00000121394] [ENSMUST00000131000] [ENSMUST00000205300]
AlphaFold Q6NV66
Predicted Effect probably benign
Transcript: ENSMUST00000050383
AA Change: Q1224K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052641
Gene: ENSMUSG00000049739
AA Change: Q1224K

DomainStartEndE-ValueType
ZnF_C2H2 8 31 1.36e-2 SMART
ZnF_C2H2 67 89 5.29e-5 SMART
ZnF_C2H2 231 253 3.21e-4 SMART
ZnF_C2H2 258 280 9.58e-3 SMART
ZnF_C2H2 286 308 2.24e-3 SMART
low complexity region 345 362 N/A INTRINSIC
ZnF_C2H2 366 388 5.42e-2 SMART
ZnF_C2H2 393 415 8.34e-3 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
ZnF_C2H2 484 506 4.87e-4 SMART
ZnF_C2H2 566 588 2.32e-1 SMART
ZnF_C2H2 606 628 6.32e-3 SMART
ZnF_C2H2 633 655 1.53e-1 SMART
low complexity region 737 750 N/A INTRINSIC
low complexity region 786 797 N/A INTRINSIC
ZnF_C2H2 806 828 2.17e-1 SMART
ZnF_C2H2 833 855 3.69e-4 SMART
ZnF_C2H2 866 889 1.16e-1 SMART
low complexity region 890 911 N/A INTRINSIC
ZnF_C2H2 941 961 9.31e1 SMART
ZnF_C2H2 1035 1057 1.95e-3 SMART
ZnF_C2H2 1062 1084 3.39e-3 SMART
low complexity region 1149 1163 N/A INTRINSIC
ZnF_C2H2 1170 1192 1.58e-3 SMART
ZnF_C2H2 1197 1219 5.42e-2 SMART
ZnF_C2H2 1225 1247 3.69e-4 SMART
ZnF_C2H2 1266 1286 5.12e1 SMART
ZnF_C2H2 1293 1315 3.69e-4 SMART
ZnF_C2H2 1333 1355 3.11e-2 SMART
ZnF_C2H2 1550 1572 5.9e-3 SMART
ZnF_C2H2 1640 1662 1.08e-1 SMART
ZnF_C2H2 1667 1689 4.11e-2 SMART
ZnF_C2H2 1695 1717 4.11e-2 SMART
ZnF_C2H2 1724 1746 1.45e-2 SMART
low complexity region 1751 1764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121394
SMART Domains Protein: ENSMUSP00000112972
Gene: ENSMUSG00000044139

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 38 268 3.91e-45 SMART
Tryp_SPc 300 520 9.95e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126662
SMART Domains Protein: ENSMUSP00000123566
Gene: ENSMUSG00000030804

DomainStartEndE-ValueType
VKc 1 111 8.84e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131000
SMART Domains Protein: ENSMUSP00000115499
Gene: ENSMUSG00000049739

DomainStartEndE-ValueType
ZnF_C2H2 8 31 1.36e-2 SMART
ZnF_C2H2 67 89 5.29e-5 SMART
ZnF_C2H2 231 253 3.21e-4 SMART
ZnF_C2H2 258 280 9.58e-3 SMART
ZnF_C2H2 286 308 2.24e-3 SMART
low complexity region 345 362 N/A INTRINSIC
ZnF_C2H2 366 388 5.42e-2 SMART
ZnF_C2H2 393 415 8.34e-3 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
ZnF_C2H2 484 506 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205300
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 63,070,120 (GRCm39) R129L probably damaging Het
Arhgef28 C T 13: 98,101,943 (GRCm39) V844I probably damaging Het
Arhgef5 T C 6: 43,265,665 (GRCm39) V1569A probably damaging Het
Atr T A 9: 95,748,747 (GRCm39) S431T probably benign Het
Cdh11 T C 8: 103,360,953 (GRCm39) D795G possibly damaging Het
Crygf T C 1: 65,967,130 (GRCm39) S85P probably benign Het
Dip2c T A 13: 9,709,314 (GRCm39) Y1385N probably damaging Het
Dnah14 G A 1: 181,454,509 (GRCm39) V840I possibly damaging Het
Dsg1a T C 18: 20,461,795 (GRCm39) F299L possibly damaging Het
Fgfr4 A T 13: 55,314,013 (GRCm39) S576C probably damaging Het
Frmd8 T C 19: 5,919,546 (GRCm39) D167G probably damaging Het
Gm5105 G A 3: 137,755,319 (GRCm39) T89I unknown Het
Grhl1 C T 12: 24,625,996 (GRCm39) S35L possibly damaging Het
Gsn A G 2: 35,183,518 (GRCm39) E242G probably benign Het
Hcrtr1 A G 4: 130,029,661 (GRCm39) I140T probably damaging Het
Ifnlr1 T C 4: 135,431,135 (GRCm39) Y208H possibly damaging Het
Ighv1-58 T C 12: 115,275,985 (GRCm39) Y51C probably damaging Het
Iqcj T A 3: 67,948,580 (GRCm39) Y21* probably null Het
Kcnc4 T C 3: 107,366,178 (GRCm39) Y10C probably benign Het
Kcnk7 G T 19: 5,756,160 (GRCm39) G129W probably damaging Het
Kcnq2 T A 2: 180,723,517 (GRCm39) R620* probably null Het
Klk13 C A 7: 43,376,126 (GRCm39) P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
L3mbtl4 G A 17: 68,793,938 (GRCm39) R314H probably damaging Het
Lamc2 T A 1: 153,012,488 (GRCm39) M729L probably benign Het
Lyst T G 13: 13,918,044 (GRCm39) probably null Het
Med13l G A 5: 118,890,051 (GRCm39) R1909H probably damaging Het
Mstn T A 1: 53,103,243 (GRCm39) L193Q possibly damaging Het
Mylk T C 16: 34,820,796 (GRCm39) V125A possibly damaging Het
Nalcn T A 14: 123,647,233 (GRCm39) M547L probably damaging Het
Nckap5 A G 1: 125,952,785 (GRCm39) S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 (GRCm38) Y189C probably damaging Het
Oosp3 T A 19: 11,676,783 (GRCm39) D47E probably benign Het
Or14j8 A T 17: 38,263,393 (GRCm39) I174N probably damaging Het
Or5d37 T A 2: 87,923,600 (GRCm39) I227F probably benign Het
Or5h25 A G 16: 58,930,970 (GRCm39) M1T probably null Het
Or5p66 T G 7: 107,885,551 (GRCm39) I261L probably benign Het
Pcdh15 G T 10: 74,302,186 (GRCm39) G942W probably damaging Het
Pcyox1l C A 18: 61,840,625 (GRCm39) probably benign Het
Peg3 T C 7: 6,711,838 (GRCm39) E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plscr1 T A 9: 92,146,715 (GRCm39) V119D probably damaging Het
Prss56 A T 1: 87,113,670 (GRCm39) D258V possibly damaging Het
Ptpn23 T G 9: 110,214,884 (GRCm39) K85Q possibly damaging Het
Ranbp3l C A 15: 9,037,159 (GRCm39) S7Y probably benign Het
Rnf31 T C 14: 55,829,690 (GRCm39) L85P probably damaging Het
Rptn T C 3: 93,305,207 (GRCm39) C847R possibly damaging Het
Six4 T A 12: 73,155,727 (GRCm39) E413D probably benign Het
Slc30a2 G A 4: 134,074,726 (GRCm39) R161Q probably damaging Het
Sned1 T C 1: 93,212,143 (GRCm39) V1115A probably damaging Het
Spen T C 4: 141,220,755 (GRCm39) K401E unknown Het
Srbd1 T A 17: 86,443,843 (GRCm39) R128W possibly damaging Het
Strc A T 2: 121,199,539 (GRCm39) I1300N probably damaging Het
Susd1 T G 4: 59,390,627 (GRCm39) T230P probably benign Het
Thumpd2 G T 17: 81,363,326 (GRCm39) S47* probably null Het
Tmprss11a C T 5: 86,576,429 (GRCm39) V141I probably damaging Het
Tmprss15 T C 16: 78,821,741 (GRCm39) Y438C possibly damaging Het
Tnfrsf1a T C 6: 125,333,914 (GRCm39) S56P probably damaging Het
Ttc39d T C 17: 80,523,610 (GRCm39) W90R probably benign Het
Utp25 A G 1: 192,797,163 (GRCm39) I563T probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Wdr20rt A T 12: 65,272,536 (GRCm39) probably null Het
Other mutations in Zfp646
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Zfp646 APN 7 127,478,302 (GRCm39) missense possibly damaging 0.91
IGL01669:Zfp646 APN 7 127,478,137 (GRCm39) missense probably benign
IGL02571:Zfp646 APN 7 127,478,584 (GRCm39) missense probably damaging 1.00
R0009:Zfp646 UTSW 7 127,479,903 (GRCm39) missense probably damaging 0.96
R0084:Zfp646 UTSW 7 127,480,476 (GRCm39) missense possibly damaging 0.86
R0140:Zfp646 UTSW 7 127,482,678 (GRCm39) missense probably benign 0.41
R0394:Zfp646 UTSW 7 127,482,434 (GRCm39) missense possibly damaging 0.85
R0571:Zfp646 UTSW 7 127,481,138 (GRCm39) missense probably damaging 0.96
R0924:Zfp646 UTSW 7 127,482,982 (GRCm39) nonsense probably null
R0930:Zfp646 UTSW 7 127,482,982 (GRCm39) nonsense probably null
R1219:Zfp646 UTSW 7 127,482,292 (GRCm39) missense probably benign
R1221:Zfp646 UTSW 7 127,482,292 (GRCm39) missense probably benign
R1351:Zfp646 UTSW 7 127,482,683 (GRCm39) missense probably benign
R1370:Zfp646 UTSW 7 127,479,036 (GRCm39) missense probably damaging 1.00
R1503:Zfp646 UTSW 7 127,479,308 (GRCm39) missense probably damaging 1.00
R1605:Zfp646 UTSW 7 127,479,359 (GRCm39) splice site probably null
R1817:Zfp646 UTSW 7 127,482,292 (GRCm39) missense probably benign
R1818:Zfp646 UTSW 7 127,482,292 (GRCm39) missense probably benign
R1819:Zfp646 UTSW 7 127,482,292 (GRCm39) missense probably benign
R1838:Zfp646 UTSW 7 127,478,911 (GRCm39) missense probably damaging 1.00
R1870:Zfp646 UTSW 7 127,483,021 (GRCm39) missense possibly damaging 0.85
R2100:Zfp646 UTSW 7 127,481,359 (GRCm39) missense probably damaging 1.00
R2763:Zfp646 UTSW 7 127,479,210 (GRCm39) nonsense probably null
R4346:Zfp646 UTSW 7 127,478,681 (GRCm39) missense probably damaging 1.00
R4770:Zfp646 UTSW 7 127,482,649 (GRCm39) missense possibly damaging 0.83
R4824:Zfp646 UTSW 7 127,482,907 (GRCm39) missense probably benign 0.00
R4936:Zfp646 UTSW 7 127,480,933 (GRCm39) missense possibly damaging 0.93
R4937:Zfp646 UTSW 7 127,478,354 (GRCm39) missense probably benign 0.01
R5062:Zfp646 UTSW 7 127,479,671 (GRCm39) missense probably damaging 0.99
R5424:Zfp646 UTSW 7 127,481,875 (GRCm39) missense possibly damaging 0.72
R5610:Zfp646 UTSW 7 127,478,530 (GRCm39) missense probably damaging 1.00
R5729:Zfp646 UTSW 7 127,484,626 (GRCm39) missense probably damaging 0.99
R6112:Zfp646 UTSW 7 127,478,190 (GRCm39) missense possibly damaging 0.71
R6161:Zfp646 UTSW 7 127,477,897 (GRCm39) missense probably damaging 1.00
R6310:Zfp646 UTSW 7 127,483,079 (GRCm39) missense probably benign 0.13
R6331:Zfp646 UTSW 7 127,482,853 (GRCm39) missense probably damaging 0.99
R6436:Zfp646 UTSW 7 127,479,113 (GRCm39) missense probably benign 0.00
R6814:Zfp646 UTSW 7 127,482,505 (GRCm39) missense probably benign 0.17
R6872:Zfp646 UTSW 7 127,482,505 (GRCm39) missense probably benign 0.17
R6903:Zfp646 UTSW 7 127,479,892 (GRCm39) missense possibly damaging 0.91
R7049:Zfp646 UTSW 7 127,479,199 (GRCm39) missense possibly damaging 0.93
R7121:Zfp646 UTSW 7 127,478,944 (GRCm39) missense possibly damaging 0.95
R7405:Zfp646 UTSW 7 127,477,968 (GRCm39) nonsense probably null
R8345:Zfp646 UTSW 7 127,483,082 (GRCm39) missense probably benign 0.12
R8545:Zfp646 UTSW 7 127,484,662 (GRCm39) missense probably benign
R8909:Zfp646 UTSW 7 127,478,515 (GRCm39) missense probably damaging 0.99
R8983:Zfp646 UTSW 7 127,480,777 (GRCm39) missense probably benign
R9001:Zfp646 UTSW 7 127,478,856 (GRCm39) missense probably damaging 0.96
R9018:Zfp646 UTSW 7 127,478,243 (GRCm39) missense probably benign
R9118:Zfp646 UTSW 7 127,480,810 (GRCm39) missense
R9414:Zfp646 UTSW 7 127,481,050 (GRCm39) missense probably damaging 0.99
Z1177:Zfp646 UTSW 7 127,479,804 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GGCCCTTTAGCTGTGAAGTG -3'
(R):5'- TGTCGCCGCTGTTGACTATC -3'

Sequencing Primer
(F):5'- GTGTGGCCGCACCTACAAG -3'
(R):5'- GCCGCTGTTGACTATCAGAATGTAC -3'
Posted On 2019-05-13