Incidental Mutation 'R7018:Ptpn23'
ID 545456
Institutional Source Beutler Lab
Gene Symbol Ptpn23
Ensembl Gene ENSMUSG00000036057
Gene Name protein tyrosine phosphatase, non-receptor type 23
Synonyms PTP-TD14
MMRRC Submission 045119-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7018 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 110214152-110237278 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 110214884 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamine at position 85 (K85Q)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040021] [ENSMUST00000098350]
AlphaFold Q6PB44
Predicted Effect probably benign
Transcript: ENSMUST00000040021
AA Change: K1533Q

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000039580
Gene: ENSMUSG00000036057
AA Change: K1533Q

DomainStartEndE-ValueType
BRO1 8 384 5.94e-159 SMART
Pfam:ALIX_LYPXL_bnd 416 704 1.4e-64 PFAM
low complexity region 715 728 N/A INTRINSIC
low complexity region 774 785 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 905 928 N/A INTRINSIC
internal_repeat_1 929 942 8.2e-5 PROSPERO
internal_repeat_1 943 956 8.2e-5 PROSPERO
low complexity region 977 1018 N/A INTRINSIC
low complexity region 1040 1061 N/A INTRINSIC
low complexity region 1088 1106 N/A INTRINSIC
low complexity region 1128 1160 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
low complexity region 1225 1235 N/A INTRINSIC
PTPc 1246 1510 1.28e-92 SMART
low complexity region 1576 1587 N/A INTRINSIC
low complexity region 1589 1643 N/A INTRINSIC
Blast:PTPc 1644 1673 9e-8 BLAST
low complexity region 1675 1689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098350
SMART Domains Protein: ENSMUSP00000095953
Gene: ENSMUSG00000032485

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
Pfam:Patched 279 504 4.7e-24 PFAM
Pfam:Sterol-sensing 308 459 7.6e-54 PFAM
transmembrane domain 515 534 N/A INTRINSIC
transmembrane domain 711 733 N/A INTRINSIC
low complexity region 741 751 N/A INTRINSIC
WD40 765 802 1.79e-1 SMART
low complexity region 847 865 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
WD40 953 990 9.86e1 SMART
low complexity region 1050 1060 N/A INTRINSIC
WD40 1062 1102 4.18e-2 SMART
WD40 1105 1143 5.64e-8 SMART
WD40 1147 1183 2.4e-1 SMART
WD40 1186 1223 2.56e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000200531
AA Change: K85Q

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the non-receptor type protein-tyrosine phosphatase family. The encoded protein may be involved in the regulation of small nuclear ribonucleo protein assembly and pre-mRNA splicing by modifying the survival motor neuron (SMN) complex. The encoded protein additionally plays a role in ciliogenesis and is part of endosomal sorting complex required for transport (ESCRT) pathways. This gene may serve a tumor suppressor function. [provided by RefSeq, Jul 2016]
PHENOTYPE: Embryos homozygous for a gene trap allele are significantly growth retarded and fail to reach the E8.5 stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 63,070,120 (GRCm39) R129L probably damaging Het
Arhgef28 C T 13: 98,101,943 (GRCm39) V844I probably damaging Het
Arhgef5 T C 6: 43,265,665 (GRCm39) V1569A probably damaging Het
Atr T A 9: 95,748,747 (GRCm39) S431T probably benign Het
Cdh11 T C 8: 103,360,953 (GRCm39) D795G possibly damaging Het
Crygf T C 1: 65,967,130 (GRCm39) S85P probably benign Het
Dip2c T A 13: 9,709,314 (GRCm39) Y1385N probably damaging Het
Dnah14 G A 1: 181,454,509 (GRCm39) V840I possibly damaging Het
Dsg1a T C 18: 20,461,795 (GRCm39) F299L possibly damaging Het
Fgfr4 A T 13: 55,314,013 (GRCm39) S576C probably damaging Het
Frmd8 T C 19: 5,919,546 (GRCm39) D167G probably damaging Het
Gm5105 G A 3: 137,755,319 (GRCm39) T89I unknown Het
Grhl1 C T 12: 24,625,996 (GRCm39) S35L possibly damaging Het
Gsn A G 2: 35,183,518 (GRCm39) E242G probably benign Het
Hcrtr1 A G 4: 130,029,661 (GRCm39) I140T probably damaging Het
Ifnlr1 T C 4: 135,431,135 (GRCm39) Y208H possibly damaging Het
Ighv1-58 T C 12: 115,275,985 (GRCm39) Y51C probably damaging Het
Iqcj T A 3: 67,948,580 (GRCm39) Y21* probably null Het
Kcnc4 T C 3: 107,366,178 (GRCm39) Y10C probably benign Het
Kcnk7 G T 19: 5,756,160 (GRCm39) G129W probably damaging Het
Kcnq2 T A 2: 180,723,517 (GRCm39) R620* probably null Het
Klk13 C A 7: 43,376,126 (GRCm39) P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
L3mbtl4 G A 17: 68,793,938 (GRCm39) R314H probably damaging Het
Lamc2 T A 1: 153,012,488 (GRCm39) M729L probably benign Het
Lyst T G 13: 13,918,044 (GRCm39) probably null Het
Med13l G A 5: 118,890,051 (GRCm39) R1909H probably damaging Het
Mstn T A 1: 53,103,243 (GRCm39) L193Q possibly damaging Het
Mylk T C 16: 34,820,796 (GRCm39) V125A possibly damaging Het
Nalcn T A 14: 123,647,233 (GRCm39) M547L probably damaging Het
Nckap5 A G 1: 125,952,785 (GRCm39) S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 (GRCm38) Y189C probably damaging Het
Oosp3 T A 19: 11,676,783 (GRCm39) D47E probably benign Het
Or14j8 A T 17: 38,263,393 (GRCm39) I174N probably damaging Het
Or5d37 T A 2: 87,923,600 (GRCm39) I227F probably benign Het
Or5h25 A G 16: 58,930,970 (GRCm39) M1T probably null Het
Or5p66 T G 7: 107,885,551 (GRCm39) I261L probably benign Het
Pcdh15 G T 10: 74,302,186 (GRCm39) G942W probably damaging Het
Pcyox1l C A 18: 61,840,625 (GRCm39) probably benign Het
Peg3 T C 7: 6,711,838 (GRCm39) E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plscr1 T A 9: 92,146,715 (GRCm39) V119D probably damaging Het
Prss56 A T 1: 87,113,670 (GRCm39) D258V possibly damaging Het
Ranbp3l C A 15: 9,037,159 (GRCm39) S7Y probably benign Het
Rnf31 T C 14: 55,829,690 (GRCm39) L85P probably damaging Het
Rptn T C 3: 93,305,207 (GRCm39) C847R possibly damaging Het
Six4 T A 12: 73,155,727 (GRCm39) E413D probably benign Het
Slc30a2 G A 4: 134,074,726 (GRCm39) R161Q probably damaging Het
Sned1 T C 1: 93,212,143 (GRCm39) V1115A probably damaging Het
Spen T C 4: 141,220,755 (GRCm39) K401E unknown Het
Srbd1 T A 17: 86,443,843 (GRCm39) R128W possibly damaging Het
Strc A T 2: 121,199,539 (GRCm39) I1300N probably damaging Het
Susd1 T G 4: 59,390,627 (GRCm39) T230P probably benign Het
Thumpd2 G T 17: 81,363,326 (GRCm39) S47* probably null Het
Tmprss11a C T 5: 86,576,429 (GRCm39) V141I probably damaging Het
Tmprss15 T C 16: 78,821,741 (GRCm39) Y438C possibly damaging Het
Tnfrsf1a T C 6: 125,333,914 (GRCm39) S56P probably damaging Het
Ttc39d T C 17: 80,523,610 (GRCm39) W90R probably benign Het
Utp25 A G 1: 192,797,163 (GRCm39) I563T probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Wdr20rt A T 12: 65,272,536 (GRCm39) probably null Het
Zfp646 C A 7: 127,481,494 (GRCm39) Q1224K probably benign Het
Other mutations in Ptpn23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Ptpn23 APN 9 110,217,174 (GRCm39) missense probably benign 0.00
IGL01462:Ptpn23 APN 9 110,237,175 (GRCm39) missense probably benign 0.33
IGL01666:Ptpn23 APN 9 110,215,613 (GRCm39) missense possibly damaging 0.95
IGL01757:Ptpn23 APN 9 110,220,704 (GRCm39) missense probably damaging 1.00
IGL02402:Ptpn23 APN 9 110,222,781 (GRCm39) missense possibly damaging 0.81
IGL02891:Ptpn23 APN 9 110,217,088 (GRCm39) nonsense probably null
peony UTSW 9 110,215,575 (GRCm39) missense probably damaging 0.97
FR4449:Ptpn23 UTSW 9 110,216,701 (GRCm39) missense probably benign 0.15
FR4548:Ptpn23 UTSW 9 110,216,701 (GRCm39) missense probably benign 0.15
FR4737:Ptpn23 UTSW 9 110,216,701 (GRCm39) missense probably benign 0.15
FR4976:Ptpn23 UTSW 9 110,216,701 (GRCm39) missense probably benign 0.15
R0111:Ptpn23 UTSW 9 110,214,691 (GRCm39) missense probably damaging 0.97
R0377:Ptpn23 UTSW 9 110,217,200 (GRCm39) missense possibly damaging 0.73
R0432:Ptpn23 UTSW 9 110,218,078 (GRCm39) critical splice donor site probably null
R0456:Ptpn23 UTSW 9 110,218,861 (GRCm39) splice site probably null
R0457:Ptpn23 UTSW 9 110,215,361 (GRCm39) missense possibly damaging 0.95
R0988:Ptpn23 UTSW 9 110,217,845 (GRCm39) missense probably benign 0.02
R1072:Ptpn23 UTSW 9 110,215,663 (GRCm39) missense probably benign 0.29
R1769:Ptpn23 UTSW 9 110,220,746 (GRCm39) missense possibly damaging 0.89
R1859:Ptpn23 UTSW 9 110,217,938 (GRCm39) missense possibly damaging 0.92
R1891:Ptpn23 UTSW 9 110,222,868 (GRCm39) missense possibly damaging 0.74
R1915:Ptpn23 UTSW 9 110,215,575 (GRCm39) missense probably damaging 0.97
R1954:Ptpn23 UTSW 9 110,215,393 (GRCm39) missense probably damaging 0.99
R2299:Ptpn23 UTSW 9 110,221,581 (GRCm39) missense possibly damaging 0.72
R2431:Ptpn23 UTSW 9 110,215,347 (GRCm39) nonsense probably null
R2445:Ptpn23 UTSW 9 110,216,700 (GRCm39) missense possibly damaging 0.79
R3014:Ptpn23 UTSW 9 110,218,763 (GRCm39) missense probably benign
R3820:Ptpn23 UTSW 9 110,218,862 (GRCm39) unclassified probably benign
R3904:Ptpn23 UTSW 9 110,218,313 (GRCm39) missense probably benign 0.11
R4441:Ptpn23 UTSW 9 110,221,793 (GRCm39) missense probably benign 0.01
R4464:Ptpn23 UTSW 9 110,215,881 (GRCm39) missense probably damaging 1.00
R4709:Ptpn23 UTSW 9 110,217,924 (GRCm39) missense possibly damaging 0.86
R4810:Ptpn23 UTSW 9 110,218,204 (GRCm39) missense possibly damaging 0.93
R4937:Ptpn23 UTSW 9 110,221,806 (GRCm39) missense probably benign 0.09
R5023:Ptpn23 UTSW 9 110,217,624 (GRCm39) missense probably benign 0.00
R5057:Ptpn23 UTSW 9 110,217,624 (GRCm39) missense probably benign 0.00
R5065:Ptpn23 UTSW 9 110,227,256 (GRCm39) missense possibly damaging 0.91
R5143:Ptpn23 UTSW 9 110,214,506 (GRCm39) unclassified probably benign
R5370:Ptpn23 UTSW 9 110,214,769 (GRCm39) missense possibly damaging 0.79
R5534:Ptpn23 UTSW 9 110,221,809 (GRCm39) missense possibly damaging 0.95
R5715:Ptpn23 UTSW 9 110,216,143 (GRCm39) missense probably damaging 1.00
R5914:Ptpn23 UTSW 9 110,214,511 (GRCm39) unclassified probably benign
R6122:Ptpn23 UTSW 9 110,216,893 (GRCm39) unclassified probably benign
R6155:Ptpn23 UTSW 9 110,216,849 (GRCm39) unclassified probably benign
R6156:Ptpn23 UTSW 9 110,216,849 (GRCm39) unclassified probably benign
R6296:Ptpn23 UTSW 9 110,222,894 (GRCm39) missense probably damaging 0.96
R6755:Ptpn23 UTSW 9 110,218,855 (GRCm39) missense probably damaging 0.98
R7126:Ptpn23 UTSW 9 110,217,812 (GRCm39) missense probably benign 0.00
R7181:Ptpn23 UTSW 9 110,214,325 (GRCm39) missense unknown
R7578:Ptpn23 UTSW 9 110,216,676 (GRCm39) missense probably benign 0.33
R7675:Ptpn23 UTSW 9 110,216,094 (GRCm39) nonsense probably null
R7776:Ptpn23 UTSW 9 110,215,368 (GRCm39) missense possibly damaging 0.89
R7797:Ptpn23 UTSW 9 110,222,875 (GRCm39) missense possibly damaging 0.86
R8071:Ptpn23 UTSW 9 110,217,268 (GRCm39) missense possibly damaging 0.93
R8071:Ptpn23 UTSW 9 110,217,267 (GRCm39) missense probably damaging 0.98
R8954:Ptpn23 UTSW 9 110,221,568 (GRCm39) missense probably damaging 1.00
R9063:Ptpn23 UTSW 9 110,218,693 (GRCm39) missense possibly damaging 0.85
R9208:Ptpn23 UTSW 9 110,237,101 (GRCm39) critical splice donor site probably null
R9380:Ptpn23 UTSW 9 110,221,581 (GRCm39) missense possibly damaging 0.72
R9404:Ptpn23 UTSW 9 110,216,025 (GRCm39) missense
R9570:Ptpn23 UTSW 9 110,227,217 (GRCm39) missense probably damaging 0.96
R9649:Ptpn23 UTSW 9 110,215,226 (GRCm39) critical splice acceptor site probably null
X0062:Ptpn23 UTSW 9 110,216,775 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCTGAGCTTGGCAATGGTAG -3'
(R):5'- GCAGAGGAAACACATGCTGC -3'

Sequencing Primer
(F):5'- CTTGGCAATGGTAGCCTGAATG -3'
(R):5'- CACATGCTGCAGGAAAAAGTG -3'
Posted On 2019-05-13