Incidental Mutation 'R7018:Grhl1'
ID 545458
Institutional Source Beutler Lab
Gene Symbol Grhl1
Ensembl Gene ENSMUSG00000020656
Gene Name grainyhead like transcription factor 1
Synonyms LBP-32, p70 MGR, p61 MGR, Tcfcp2l2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7018 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 24572283-24617391 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 24575997 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 35 (S35L)
Ref Sequence ENSEMBL: ENSMUSP00000082689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020985] [ENSMUST00000085553]
AlphaFold Q921D9
Predicted Effect probably benign
Transcript: ENSMUST00000020985
SMART Domains Protein: ENSMUSP00000020985
Gene: ENSMUSG00000020656

DomainStartEndE-ValueType
Pfam:CP2 133 362 1.8e-87 PFAM
low complexity region 406 421 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085553
AA Change: S35L

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000082689
Gene: ENSMUSG00000020656
AA Change: S35L

DomainStartEndE-ValueType
Pfam:CP2 228 442 1.9e-82 PFAM
low complexity region 488 503 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein can exist as a homodimer or can form heterodimers with sister-of-mammalian grainyhead or brother-of-mammalian grainyhead. This protein functions as a transcription factor during development. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null allele display alopecia or sparse hair, abnormal hair follicle root sheaths, thickening of the cornified layer on the paws, and postnatal growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 62,937,049 R129L probably damaging Het
Arhgef28 C T 13: 97,965,435 V844I probably damaging Het
Arhgef5 T C 6: 43,288,731 V1569A probably damaging Het
Atr T A 9: 95,866,694 S431T probably benign Het
Cdh11 T C 8: 102,634,321 D795G possibly damaging Het
Crygf T C 1: 65,927,971 S85P probably benign Het
Diexf A G 1: 193,114,855 I563T probably benign Het
Dip2c T A 13: 9,659,278 Y1385N probably damaging Het
Dnah14 G A 1: 181,626,944 V840I possibly damaging Het
Dsg1a T C 18: 20,328,738 F299L possibly damaging Het
Fgfr4 A T 13: 55,166,200 S576C probably damaging Het
Frmd8 T C 19: 5,869,518 D167G probably damaging Het
Gm5105 G A 3: 138,049,558 T89I unknown Het
Gsn A G 2: 35,293,506 E242G probably benign Het
Hcrtr1 A G 4: 130,135,868 I140T probably damaging Het
Ifnlr1 T C 4: 135,703,824 Y208H possibly damaging Het
Ighv1-58 T C 12: 115,312,365 Y51C probably damaging Het
Iqcj T A 3: 68,041,247 Y21* probably null Het
Kcnc4 T C 3: 107,458,862 Y10C probably benign Het
Kcnk7 G T 19: 5,706,132 G129W probably damaging Het
Kcnq2 T A 2: 181,081,724 R620* probably null Het
Klk13 C A 7: 43,726,702 P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
L3mbtl4 G A 17: 68,486,943 R314H probably damaging Het
Lamc2 T A 1: 153,136,742 M729L probably benign Het
Lyst T G 13: 13,743,459 probably null Het
Med13l G A 5: 118,751,986 R1909H probably damaging Het
Mstn T A 1: 53,064,084 L193Q possibly damaging Het
Mylk T C 16: 35,000,426 V125A possibly damaging Het
Nalcn T A 14: 123,409,821 M547L probably damaging Het
Nckap5 A G 1: 126,025,048 S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 Y189C probably damaging Het
Olfr1164 T A 2: 88,093,256 I227F probably benign Het
Olfr193 A G 16: 59,110,607 M1T probably null Het
Olfr490 T G 7: 108,286,344 I261L probably benign Het
Olfr761 A T 17: 37,952,502 I174N probably damaging Het
Oosp3 T A 19: 11,699,419 D47E probably benign Het
Pcdh15 G T 10: 74,466,354 G942W probably damaging Het
Pcyox1l C A 18: 61,707,554 probably benign Het
Peg3 T C 7: 6,708,839 E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plscr1 T A 9: 92,264,662 V119D probably damaging Het
Prss56 A T 1: 87,185,948 D258V possibly damaging Het
Ptpn23 T G 9: 110,385,816 K85Q possibly damaging Het
Ranbp3l C A 15: 9,007,285 S7Y probably benign Het
Rnf31 T C 14: 55,592,233 L85P probably damaging Het
Rptn T C 3: 93,397,900 C847R possibly damaging Het
Six4 T A 12: 73,108,953 E413D probably benign Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Sned1 T C 1: 93,284,421 V1115A probably damaging Het
Spen T C 4: 141,493,444 K401E unknown Het
Srbd1 T A 17: 86,136,415 R128W possibly damaging Het
Strc A T 2: 121,369,058 I1300N probably damaging Het
Susd1 T G 4: 59,390,627 T230P probably benign Het
Thumpd2 G T 17: 81,055,897 S47* probably null Het
Tmprss11a C T 5: 86,428,570 V141I probably damaging Het
Tmprss15 T C 16: 79,024,853 Y438C possibly damaging Het
Tnfrsf1a T C 6: 125,356,951 S56P probably damaging Het
Ttc39d T C 17: 80,216,181 W90R probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20rt A T 12: 65,225,762 probably null Het
Zfp646 C A 7: 127,882,322 Q1224K probably benign Het
Other mutations in Grhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Grhl1 APN 12 24612170 missense probably damaging 1.00
IGL01104:Grhl1 APN 12 24584454 missense probably damaging 1.00
IGL01335:Grhl1 APN 12 24608058 missense probably damaging 1.00
IGL01660:Grhl1 APN 12 24608578 splice site probably null
IGL01725:Grhl1 APN 12 24609748 splice site probably benign
IGL02869:Grhl1 APN 12 24581491 missense probably damaging 1.00
bandit UTSW 12 24578027 missense probably benign 0.31
cembalo UTSW 12 24586152 critical splice donor site probably null
gamba UTSW 12 24612245 splice site probably benign
Spinnet UTSW 12 24584946 critical splice donor site probably null
R0048:Grhl1 UTSW 12 24612151 splice site probably benign
R0373:Grhl1 UTSW 12 24581515 missense probably benign 0.00
R0432:Grhl1 UTSW 12 24582919 missense probably benign 0.29
R0442:Grhl1 UTSW 12 24612170 missense probably damaging 1.00
R1531:Grhl1 UTSW 12 24582963 critical splice donor site probably null
R1646:Grhl1 UTSW 12 24611861 missense possibly damaging 0.64
R1874:Grhl1 UTSW 12 24586156 splice site probably benign
R1892:Grhl1 UTSW 12 24584910 missense probably damaging 1.00
R1908:Grhl1 UTSW 12 24608556 missense probably damaging 0.99
R2051:Grhl1 UTSW 12 24586152 critical splice donor site probably null
R2199:Grhl1 UTSW 12 24612170 missense probably damaging 1.00
R2233:Grhl1 UTSW 12 24608511 missense probably damaging 0.98
R3803:Grhl1 UTSW 12 24584919 missense probably damaging 1.00
R3864:Grhl1 UTSW 12 24615930 makesense probably null
R4227:Grhl1 UTSW 12 24611851 missense probably benign
R4682:Grhl1 UTSW 12 24608433 missense probably benign 0.00
R4709:Grhl1 UTSW 12 24586133 missense possibly damaging 0.57
R5096:Grhl1 UTSW 12 24603050 missense probably damaging 1.00
R5149:Grhl1 UTSW 12 24612179 small deletion probably benign
R5580:Grhl1 UTSW 12 24609740 missense probably benign 0.00
R6035:Grhl1 UTSW 12 24608450 missense probably benign 0.00
R6035:Grhl1 UTSW 12 24608450 missense probably benign 0.00
R6110:Grhl1 UTSW 12 24580747 splice site probably null
R6351:Grhl1 UTSW 12 24584858 missense probably damaging 0.98
R8211:Grhl1 UTSW 12 24586152 critical splice donor site probably null
R8723:Grhl1 UTSW 12 24612245 splice site probably benign
R8898:Grhl1 UTSW 12 24584946 critical splice donor site probably null
R9575:Grhl1 UTSW 12 24586083 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTGTGTCCTATTTTAGAGGAATG -3'
(R):5'- ATAGGCTGCTGAATCAGGTGC -3'

Sequencing Primer
(F):5'- GTCAAAGAACTGTTTATTTAGCTTGG -3'
(R):5'- AATCAGGTGCGTCTGAGC -3'
Posted On 2019-05-13