Incidental Mutation 'R7018:Grhl1'
ID 545458
Institutional Source Beutler Lab
Gene Symbol Grhl1
Ensembl Gene ENSMUSG00000020656
Gene Name grainyhead like transcription factor 1
Synonyms p70 MGR, Tcfcp2l2, p61 MGR, LBP-32
MMRRC Submission 045119-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7018 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 24622282-24667390 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 24625996 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 35 (S35L)
Ref Sequence ENSEMBL: ENSMUSP00000082689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020985] [ENSMUST00000085553]
AlphaFold Q921D9
Predicted Effect probably benign
Transcript: ENSMUST00000020985
SMART Domains Protein: ENSMUSP00000020985
Gene: ENSMUSG00000020656

DomainStartEndE-ValueType
Pfam:CP2 133 362 1.8e-87 PFAM
low complexity region 406 421 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085553
AA Change: S35L

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000082689
Gene: ENSMUSG00000020656
AA Change: S35L

DomainStartEndE-ValueType
Pfam:CP2 228 442 1.9e-82 PFAM
low complexity region 488 503 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein can exist as a homodimer or can form heterodimers with sister-of-mammalian grainyhead or brother-of-mammalian grainyhead. This protein functions as a transcription factor during development. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null allele display alopecia or sparse hair, abnormal hair follicle root sheaths, thickening of the cornified layer on the paws, and postnatal growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 63,070,120 (GRCm39) R129L probably damaging Het
Arhgef28 C T 13: 98,101,943 (GRCm39) V844I probably damaging Het
Arhgef5 T C 6: 43,265,665 (GRCm39) V1569A probably damaging Het
Atr T A 9: 95,748,747 (GRCm39) S431T probably benign Het
Cdh11 T C 8: 103,360,953 (GRCm39) D795G possibly damaging Het
Crygf T C 1: 65,967,130 (GRCm39) S85P probably benign Het
Dip2c T A 13: 9,709,314 (GRCm39) Y1385N probably damaging Het
Dnah14 G A 1: 181,454,509 (GRCm39) V840I possibly damaging Het
Dsg1a T C 18: 20,461,795 (GRCm39) F299L possibly damaging Het
Fgfr4 A T 13: 55,314,013 (GRCm39) S576C probably damaging Het
Frmd8 T C 19: 5,919,546 (GRCm39) D167G probably damaging Het
Gm5105 G A 3: 137,755,319 (GRCm39) T89I unknown Het
Gsn A G 2: 35,183,518 (GRCm39) E242G probably benign Het
Hcrtr1 A G 4: 130,029,661 (GRCm39) I140T probably damaging Het
Ifnlr1 T C 4: 135,431,135 (GRCm39) Y208H possibly damaging Het
Ighv1-58 T C 12: 115,275,985 (GRCm39) Y51C probably damaging Het
Iqcj T A 3: 67,948,580 (GRCm39) Y21* probably null Het
Kcnc4 T C 3: 107,366,178 (GRCm39) Y10C probably benign Het
Kcnk7 G T 19: 5,756,160 (GRCm39) G129W probably damaging Het
Kcnq2 T A 2: 180,723,517 (GRCm39) R620* probably null Het
Klk13 C A 7: 43,376,126 (GRCm39) P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
L3mbtl4 G A 17: 68,793,938 (GRCm39) R314H probably damaging Het
Lamc2 T A 1: 153,012,488 (GRCm39) M729L probably benign Het
Lyst T G 13: 13,918,044 (GRCm39) probably null Het
Med13l G A 5: 118,890,051 (GRCm39) R1909H probably damaging Het
Mstn T A 1: 53,103,243 (GRCm39) L193Q possibly damaging Het
Mylk T C 16: 34,820,796 (GRCm39) V125A possibly damaging Het
Nalcn T A 14: 123,647,233 (GRCm39) M547L probably damaging Het
Nckap5 A G 1: 125,952,785 (GRCm39) S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 (GRCm38) Y189C probably damaging Het
Oosp3 T A 19: 11,676,783 (GRCm39) D47E probably benign Het
Or14j8 A T 17: 38,263,393 (GRCm39) I174N probably damaging Het
Or5d37 T A 2: 87,923,600 (GRCm39) I227F probably benign Het
Or5h25 A G 16: 58,930,970 (GRCm39) M1T probably null Het
Or5p66 T G 7: 107,885,551 (GRCm39) I261L probably benign Het
Pcdh15 G T 10: 74,302,186 (GRCm39) G942W probably damaging Het
Pcyox1l C A 18: 61,840,625 (GRCm39) probably benign Het
Peg3 T C 7: 6,711,838 (GRCm39) E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plscr1 T A 9: 92,146,715 (GRCm39) V119D probably damaging Het
Prss56 A T 1: 87,113,670 (GRCm39) D258V possibly damaging Het
Ptpn23 T G 9: 110,214,884 (GRCm39) K85Q possibly damaging Het
Ranbp3l C A 15: 9,037,159 (GRCm39) S7Y probably benign Het
Rnf31 T C 14: 55,829,690 (GRCm39) L85P probably damaging Het
Rptn T C 3: 93,305,207 (GRCm39) C847R possibly damaging Het
Six4 T A 12: 73,155,727 (GRCm39) E413D probably benign Het
Slc30a2 G A 4: 134,074,726 (GRCm39) R161Q probably damaging Het
Sned1 T C 1: 93,212,143 (GRCm39) V1115A probably damaging Het
Spen T C 4: 141,220,755 (GRCm39) K401E unknown Het
Srbd1 T A 17: 86,443,843 (GRCm39) R128W possibly damaging Het
Strc A T 2: 121,199,539 (GRCm39) I1300N probably damaging Het
Susd1 T G 4: 59,390,627 (GRCm39) T230P probably benign Het
Thumpd2 G T 17: 81,363,326 (GRCm39) S47* probably null Het
Tmprss11a C T 5: 86,576,429 (GRCm39) V141I probably damaging Het
Tmprss15 T C 16: 78,821,741 (GRCm39) Y438C possibly damaging Het
Tnfrsf1a T C 6: 125,333,914 (GRCm39) S56P probably damaging Het
Ttc39d T C 17: 80,523,610 (GRCm39) W90R probably benign Het
Utp25 A G 1: 192,797,163 (GRCm39) I563T probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Wdr20rt A T 12: 65,272,536 (GRCm39) probably null Het
Zfp646 C A 7: 127,481,494 (GRCm39) Q1224K probably benign Het
Other mutations in Grhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Grhl1 APN 12 24,662,169 (GRCm39) missense probably damaging 1.00
IGL01104:Grhl1 APN 12 24,634,453 (GRCm39) missense probably damaging 1.00
IGL01335:Grhl1 APN 12 24,658,057 (GRCm39) missense probably damaging 1.00
IGL01660:Grhl1 APN 12 24,658,577 (GRCm39) splice site probably null
IGL01725:Grhl1 APN 12 24,659,747 (GRCm39) splice site probably benign
IGL02869:Grhl1 APN 12 24,631,490 (GRCm39) missense probably damaging 1.00
bandit UTSW 12 24,628,025 (GRCm39) missense probably benign 0.31
cembalo UTSW 12 24,636,151 (GRCm39) critical splice donor site probably null
gamba UTSW 12 24,662,244 (GRCm39) splice site probably benign
Spinnet UTSW 12 24,634,945 (GRCm39) critical splice donor site probably null
R0048:Grhl1 UTSW 12 24,662,150 (GRCm39) splice site probably benign
R0373:Grhl1 UTSW 12 24,631,514 (GRCm39) missense probably benign 0.00
R0432:Grhl1 UTSW 12 24,632,918 (GRCm39) missense probably benign 0.29
R0442:Grhl1 UTSW 12 24,662,169 (GRCm39) missense probably damaging 1.00
R1531:Grhl1 UTSW 12 24,632,962 (GRCm39) critical splice donor site probably null
R1646:Grhl1 UTSW 12 24,661,860 (GRCm39) missense possibly damaging 0.64
R1874:Grhl1 UTSW 12 24,636,155 (GRCm39) splice site probably benign
R1892:Grhl1 UTSW 12 24,634,909 (GRCm39) missense probably damaging 1.00
R1908:Grhl1 UTSW 12 24,658,555 (GRCm39) missense probably damaging 0.99
R2051:Grhl1 UTSW 12 24,636,151 (GRCm39) critical splice donor site probably null
R2199:Grhl1 UTSW 12 24,662,169 (GRCm39) missense probably damaging 1.00
R2233:Grhl1 UTSW 12 24,658,510 (GRCm39) missense probably damaging 0.98
R3803:Grhl1 UTSW 12 24,634,918 (GRCm39) missense probably damaging 1.00
R3864:Grhl1 UTSW 12 24,665,929 (GRCm39) makesense probably null
R4227:Grhl1 UTSW 12 24,661,850 (GRCm39) missense probably benign
R4682:Grhl1 UTSW 12 24,658,432 (GRCm39) missense probably benign 0.00
R4709:Grhl1 UTSW 12 24,636,132 (GRCm39) missense possibly damaging 0.57
R5096:Grhl1 UTSW 12 24,653,049 (GRCm39) missense probably damaging 1.00
R5149:Grhl1 UTSW 12 24,662,178 (GRCm39) small deletion probably benign
R5580:Grhl1 UTSW 12 24,659,739 (GRCm39) missense probably benign 0.00
R6035:Grhl1 UTSW 12 24,658,449 (GRCm39) missense probably benign 0.00
R6035:Grhl1 UTSW 12 24,658,449 (GRCm39) missense probably benign 0.00
R6110:Grhl1 UTSW 12 24,630,746 (GRCm39) splice site probably null
R6351:Grhl1 UTSW 12 24,634,857 (GRCm39) missense probably damaging 0.98
R8211:Grhl1 UTSW 12 24,636,151 (GRCm39) critical splice donor site probably null
R8723:Grhl1 UTSW 12 24,662,244 (GRCm39) splice site probably benign
R8898:Grhl1 UTSW 12 24,634,945 (GRCm39) critical splice donor site probably null
R9575:Grhl1 UTSW 12 24,636,082 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTGTGTCCTATTTTAGAGGAATG -3'
(R):5'- ATAGGCTGCTGAATCAGGTGC -3'

Sequencing Primer
(F):5'- GTCAAAGAACTGTTTATTTAGCTTGG -3'
(R):5'- AATCAGGTGCGTCTGAGC -3'
Posted On 2019-05-13