Incidental Mutation 'R7018:Nalcn'
ID 545466
Institutional Source Beutler Lab
Gene Symbol Nalcn
Ensembl Gene ENSMUSG00000000197
Gene Name sodium leak channel, non-selective
Synonyms Vgcnl1, A530023G15Rik
MMRRC Submission 045119-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7018 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 123514046-123864556 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 123647233 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 547 (M547L)
Ref Sequence ENSEMBL: ENSMUSP00000000201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000201]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000000201
AA Change: M547L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000201
Gene: ENSMUSG00000000197
AA Change: M547L

DomainStartEndE-ValueType
Pfam:Ion_trans 35 333 2.8e-37 PFAM
low complexity region 338 348 N/A INTRINSIC
Pfam:Ion_trans 383 609 5.7e-34 PFAM
coiled coil region 796 830 N/A INTRINSIC
Pfam:Ion_trans 885 1166 2.4e-42 PFAM
Pfam:Ion_trans 1209 1458 6.9e-30 PFAM
low complexity region 1548 1560 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NALCN forms a voltage-independent, nonselective, noninactivating cation channel permeable to Na+, K+, and Ca(2+). It is responsible for the neuronal background sodium leak conductance (Lu et al., 2007 [PubMed 17448995]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal breathing at birth and die within 24 hours. Mice homozygous for a gain of function ENU mutation exhibit reduced the total amount and episode duration of REMS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 63,070,120 (GRCm39) R129L probably damaging Het
Arhgef28 C T 13: 98,101,943 (GRCm39) V844I probably damaging Het
Arhgef5 T C 6: 43,265,665 (GRCm39) V1569A probably damaging Het
Atr T A 9: 95,748,747 (GRCm39) S431T probably benign Het
Cdh11 T C 8: 103,360,953 (GRCm39) D795G possibly damaging Het
Crygf T C 1: 65,967,130 (GRCm39) S85P probably benign Het
Dip2c T A 13: 9,709,314 (GRCm39) Y1385N probably damaging Het
Dnah14 G A 1: 181,454,509 (GRCm39) V840I possibly damaging Het
Dsg1a T C 18: 20,461,795 (GRCm39) F299L possibly damaging Het
Fgfr4 A T 13: 55,314,013 (GRCm39) S576C probably damaging Het
Frmd8 T C 19: 5,919,546 (GRCm39) D167G probably damaging Het
Gm5105 G A 3: 137,755,319 (GRCm39) T89I unknown Het
Grhl1 C T 12: 24,625,996 (GRCm39) S35L possibly damaging Het
Gsn A G 2: 35,183,518 (GRCm39) E242G probably benign Het
Hcrtr1 A G 4: 130,029,661 (GRCm39) I140T probably damaging Het
Ifnlr1 T C 4: 135,431,135 (GRCm39) Y208H possibly damaging Het
Ighv1-58 T C 12: 115,275,985 (GRCm39) Y51C probably damaging Het
Iqcj T A 3: 67,948,580 (GRCm39) Y21* probably null Het
Kcnc4 T C 3: 107,366,178 (GRCm39) Y10C probably benign Het
Kcnk7 G T 19: 5,756,160 (GRCm39) G129W probably damaging Het
Kcnq2 T A 2: 180,723,517 (GRCm39) R620* probably null Het
Klk13 C A 7: 43,376,126 (GRCm39) P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
L3mbtl4 G A 17: 68,793,938 (GRCm39) R314H probably damaging Het
Lamc2 T A 1: 153,012,488 (GRCm39) M729L probably benign Het
Lyst T G 13: 13,918,044 (GRCm39) probably null Het
Med13l G A 5: 118,890,051 (GRCm39) R1909H probably damaging Het
Mstn T A 1: 53,103,243 (GRCm39) L193Q possibly damaging Het
Mylk T C 16: 34,820,796 (GRCm39) V125A possibly damaging Het
Nckap5 A G 1: 125,952,785 (GRCm39) S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 (GRCm38) Y189C probably damaging Het
Oosp3 T A 19: 11,676,783 (GRCm39) D47E probably benign Het
Or14j8 A T 17: 38,263,393 (GRCm39) I174N probably damaging Het
Or5d37 T A 2: 87,923,600 (GRCm39) I227F probably benign Het
Or5h25 A G 16: 58,930,970 (GRCm39) M1T probably null Het
Or5p66 T G 7: 107,885,551 (GRCm39) I261L probably benign Het
Pcdh15 G T 10: 74,302,186 (GRCm39) G942W probably damaging Het
Pcyox1l C A 18: 61,840,625 (GRCm39) probably benign Het
Peg3 T C 7: 6,711,838 (GRCm39) E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plscr1 T A 9: 92,146,715 (GRCm39) V119D probably damaging Het
Prss56 A T 1: 87,113,670 (GRCm39) D258V possibly damaging Het
Ptpn23 T G 9: 110,214,884 (GRCm39) K85Q possibly damaging Het
Ranbp3l C A 15: 9,037,159 (GRCm39) S7Y probably benign Het
Rnf31 T C 14: 55,829,690 (GRCm39) L85P probably damaging Het
Rptn T C 3: 93,305,207 (GRCm39) C847R possibly damaging Het
Six4 T A 12: 73,155,727 (GRCm39) E413D probably benign Het
Slc30a2 G A 4: 134,074,726 (GRCm39) R161Q probably damaging Het
Sned1 T C 1: 93,212,143 (GRCm39) V1115A probably damaging Het
Spen T C 4: 141,220,755 (GRCm39) K401E unknown Het
Srbd1 T A 17: 86,443,843 (GRCm39) R128W possibly damaging Het
Strc A T 2: 121,199,539 (GRCm39) I1300N probably damaging Het
Susd1 T G 4: 59,390,627 (GRCm39) T230P probably benign Het
Thumpd2 G T 17: 81,363,326 (GRCm39) S47* probably null Het
Tmprss11a C T 5: 86,576,429 (GRCm39) V141I probably damaging Het
Tmprss15 T C 16: 78,821,741 (GRCm39) Y438C possibly damaging Het
Tnfrsf1a T C 6: 125,333,914 (GRCm39) S56P probably damaging Het
Ttc39d T C 17: 80,523,610 (GRCm39) W90R probably benign Het
Utp25 A G 1: 192,797,163 (GRCm39) I563T probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Wdr20rt A T 12: 65,272,536 (GRCm39) probably null Het
Zfp646 C A 7: 127,481,494 (GRCm39) Q1224K probably benign Het
Other mutations in Nalcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Nalcn APN 14 123,586,201 (GRCm39) missense probably benign 0.00
IGL00964:Nalcn APN 14 123,532,796 (GRCm39) splice site probably benign
IGL01310:Nalcn APN 14 123,554,661 (GRCm39) missense probably benign 0.00
IGL01578:Nalcn APN 14 123,809,503 (GRCm39) missense probably benign 0.00
IGL01925:Nalcn APN 14 123,529,260 (GRCm39) missense possibly damaging 0.88
IGL02072:Nalcn APN 14 123,560,770 (GRCm39) missense probably benign 0.05
IGL02096:Nalcn APN 14 123,831,915 (GRCm39) missense probably benign 0.11
IGL02212:Nalcn APN 14 123,752,742 (GRCm39) missense probably damaging 0.99
IGL02306:Nalcn APN 14 123,560,750 (GRCm39) missense probably benign 0.07
IGL02471:Nalcn APN 14 123,560,726 (GRCm39) missense probably benign 0.02
IGL02478:Nalcn APN 14 123,558,717 (GRCm39) missense probably benign 0.26
IGL02551:Nalcn APN 14 123,560,750 (GRCm39) missense probably benign 0.07
IGL02630:Nalcn APN 14 123,555,291 (GRCm39) missense probably benign 0.16
IGL02632:Nalcn APN 14 123,555,265 (GRCm39) missense probably benign 0.11
IGL02661:Nalcn APN 14 123,830,321 (GRCm39) splice site probably benign
IGL02830:Nalcn APN 14 123,530,881 (GRCm39) missense probably damaging 0.98
IGL02939:Nalcn APN 14 123,536,284 (GRCm39) missense probably null 1.00
IGL03035:Nalcn APN 14 123,515,630 (GRCm39) nonsense probably null
IGL03226:Nalcn APN 14 123,518,527 (GRCm39) missense probably benign 0.00
IGL03242:Nalcn APN 14 123,558,899 (GRCm39) missense possibly damaging 0.91
Narnia UTSW 14 123,528,459 (GRCm39) missense probably benign 0.11
R0019:Nalcn UTSW 14 123,744,901 (GRCm39) missense probably benign 0.18
R0144:Nalcn UTSW 14 123,647,251 (GRCm39) splice site probably benign
R0144:Nalcn UTSW 14 123,608,948 (GRCm39) missense probably damaging 0.96
R0359:Nalcn UTSW 14 123,536,580 (GRCm39) missense probably damaging 1.00
R0383:Nalcn UTSW 14 123,744,971 (GRCm39) missense probably benign 0.01
R0400:Nalcn UTSW 14 123,528,372 (GRCm39) splice site probably benign
R0467:Nalcn UTSW 14 123,528,459 (GRCm39) missense probably benign 0.11
R0506:Nalcn UTSW 14 123,834,026 (GRCm39) missense possibly damaging 0.82
R0583:Nalcn UTSW 14 123,531,755 (GRCm39) missense possibly damaging 0.46
R0620:Nalcn UTSW 14 123,536,553 (GRCm39) splice site probably benign
R0624:Nalcn UTSW 14 123,607,444 (GRCm39) missense probably benign
R0883:Nalcn UTSW 14 123,702,152 (GRCm39) missense probably damaging 1.00
R1381:Nalcn UTSW 14 123,551,517 (GRCm39) missense probably damaging 1.00
R1467:Nalcn UTSW 14 123,702,068 (GRCm39) splice site probably benign
R1689:Nalcn UTSW 14 123,522,666 (GRCm39) missense probably damaging 1.00
R1726:Nalcn UTSW 14 123,545,816 (GRCm39) missense probably damaging 1.00
R1774:Nalcn UTSW 14 123,515,678 (GRCm39) missense probably benign
R1854:Nalcn UTSW 14 123,697,824 (GRCm39) missense probably damaging 1.00
R1869:Nalcn UTSW 14 123,831,965 (GRCm39) missense possibly damaging 0.96
R1871:Nalcn UTSW 14 123,831,965 (GRCm39) missense possibly damaging 0.96
R1873:Nalcn UTSW 14 123,521,013 (GRCm39) missense probably benign 0.00
R1899:Nalcn UTSW 14 123,553,538 (GRCm39) missense possibly damaging 0.50
R1915:Nalcn UTSW 14 123,540,181 (GRCm39) missense probably benign 0.08
R2016:Nalcn UTSW 14 123,831,993 (GRCm39) splice site probably null
R2034:Nalcn UTSW 14 123,521,015 (GRCm39) missense probably benign 0.01
R2087:Nalcn UTSW 14 123,518,557 (GRCm39) missense probably benign
R2149:Nalcn UTSW 14 123,607,429 (GRCm39) missense probably benign 0.01
R2157:Nalcn UTSW 14 123,647,164 (GRCm39) missense probably benign 0.32
R2166:Nalcn UTSW 14 123,607,363 (GRCm39) missense probably benign 0.00
R2932:Nalcn UTSW 14 123,830,430 (GRCm39) missense probably benign 0.06
R3408:Nalcn UTSW 14 123,834,029 (GRCm39) missense probably null 0.98
R3778:Nalcn UTSW 14 123,702,128 (GRCm39) missense probably damaging 1.00
R3807:Nalcn UTSW 14 123,515,599 (GRCm39) missense probably damaging 1.00
R3835:Nalcn UTSW 14 123,530,834 (GRCm39) splice site probably benign
R3937:Nalcn UTSW 14 123,607,357 (GRCm39) missense probably benign 0.00
R4001:Nalcn UTSW 14 123,834,006 (GRCm39) missense probably damaging 1.00
R4015:Nalcn UTSW 14 123,723,799 (GRCm39) missense probably damaging 1.00
R4033:Nalcn UTSW 14 123,837,401 (GRCm39) splice site probably benign
R4231:Nalcn UTSW 14 123,837,325 (GRCm39) missense probably benign 0.01
R4464:Nalcn UTSW 14 123,560,762 (GRCm39) missense probably benign
R4512:Nalcn UTSW 14 123,532,860 (GRCm39) missense probably damaging 1.00
R4542:Nalcn UTSW 14 123,558,889 (GRCm39) synonymous silent
R4557:Nalcn UTSW 14 123,558,647 (GRCm39) intron probably benign
R4869:Nalcn UTSW 14 123,837,296 (GRCm39) missense probably benign 0.44
R5083:Nalcn UTSW 14 123,560,706 (GRCm39) splice site probably null
R5109:Nalcn UTSW 14 123,515,650 (GRCm39) missense possibly damaging 0.86
R5131:Nalcn UTSW 14 123,753,182 (GRCm39) missense probably damaging 0.98
R5158:Nalcn UTSW 14 123,753,149 (GRCm39) missense probably damaging 1.00
R5259:Nalcn UTSW 14 123,753,063 (GRCm39) missense possibly damaging 0.94
R5422:Nalcn UTSW 14 123,752,777 (GRCm39) missense probably damaging 1.00
R5514:Nalcn UTSW 14 123,521,123 (GRCm39) missense probably benign 0.14
R5523:Nalcn UTSW 14 123,647,155 (GRCm39) missense probably damaging 1.00
R5551:Nalcn UTSW 14 123,515,698 (GRCm39) missense possibly damaging 0.57
R5667:Nalcn UTSW 14 123,532,818 (GRCm39) missense probably damaging 1.00
R5671:Nalcn UTSW 14 123,532,818 (GRCm39) missense probably damaging 1.00
R5750:Nalcn UTSW 14 123,809,450 (GRCm39) missense probably benign
R5765:Nalcn UTSW 14 123,702,138 (GRCm39) missense possibly damaging 0.46
R6324:Nalcn UTSW 14 123,647,161 (GRCm39) missense possibly damaging 0.83
R6523:Nalcn UTSW 14 123,555,255 (GRCm39) missense probably benign 0.00
R6558:Nalcn UTSW 14 123,723,919 (GRCm39) missense probably benign
R6631:Nalcn UTSW 14 123,697,663 (GRCm39) missense probably benign 0.17
R6667:Nalcn UTSW 14 123,558,735 (GRCm39) missense probably damaging 1.00
R6670:Nalcn UTSW 14 123,702,084 (GRCm39) missense possibly damaging 0.96
R6724:Nalcn UTSW 14 123,535,479 (GRCm39) missense probably damaging 0.99
R6731:Nalcn UTSW 14 123,837,346 (GRCm39) missense probably benign 0.22
R6957:Nalcn UTSW 14 123,744,966 (GRCm39) missense probably damaging 0.96
R6970:Nalcn UTSW 14 123,551,506 (GRCm39) missense possibly damaging 0.46
R7010:Nalcn UTSW 14 123,530,877 (GRCm39) missense probably damaging 1.00
R7040:Nalcn UTSW 14 123,525,267 (GRCm39) missense probably benign
R7089:Nalcn UTSW 14 123,515,761 (GRCm39) missense probably benign 0.01
R7128:Nalcn UTSW 14 123,831,914 (GRCm39) missense probably damaging 0.99
R7149:Nalcn UTSW 14 123,837,277 (GRCm39) missense probably benign 0.02
R7361:Nalcn UTSW 14 123,529,251 (GRCm39) missense probably benign 0.00
R7378:Nalcn UTSW 14 123,540,302 (GRCm39) missense probably damaging 1.00
R7408:Nalcn UTSW 14 123,529,272 (GRCm39) missense probably benign 0.00
R7470:Nalcn UTSW 14 123,809,456 (GRCm39) missense probably benign 0.09
R7483:Nalcn UTSW 14 123,551,499 (GRCm39) missense probably damaging 1.00
R7521:Nalcn UTSW 14 123,530,870 (GRCm39) missense probably damaging 1.00
R7558:Nalcn UTSW 14 123,723,797 (GRCm39) critical splice donor site probably null
R7585:Nalcn UTSW 14 123,753,050 (GRCm39) missense probably damaging 1.00
R7591:Nalcn UTSW 14 123,561,297 (GRCm39) missense probably benign 0.01
R7761:Nalcn UTSW 14 123,531,792 (GRCm39) missense probably damaging 1.00
R7761:Nalcn UTSW 14 123,531,791 (GRCm39) missense probably damaging 1.00
R7811:Nalcn UTSW 14 123,536,357 (GRCm39) missense probably damaging 1.00
R7983:Nalcn UTSW 14 123,830,409 (GRCm39) missense probably benign 0.17
R8089:Nalcn UTSW 14 123,537,372 (GRCm39) missense probably damaging 1.00
R8110:Nalcn UTSW 14 123,702,113 (GRCm39) missense probably benign 0.00
R8190:Nalcn UTSW 14 123,837,351 (GRCm39) missense possibly damaging 0.69
R8273:Nalcn UTSW 14 123,554,436 (GRCm39) missense probably damaging 1.00
R8407:Nalcn UTSW 14 123,554,683 (GRCm39) missense probably damaging 1.00
R8497:Nalcn UTSW 14 123,752,771 (GRCm39) missense probably damaging 1.00
R8544:Nalcn UTSW 14 123,608,935 (GRCm39) missense probably benign 0.40
R8549:Nalcn UTSW 14 123,607,448 (GRCm39) missense probably benign 0.01
R8731:Nalcn UTSW 14 123,837,266 (GRCm39) missense probably benign 0.01
R8862:Nalcn UTSW 14 123,647,199 (GRCm39) missense possibly damaging 0.96
R8919:Nalcn UTSW 14 123,561,284 (GRCm39) missense probably benign 0.00
R9072:Nalcn UTSW 14 123,532,863 (GRCm39) missense possibly damaging 0.66
R9073:Nalcn UTSW 14 123,532,863 (GRCm39) missense possibly damaging 0.66
R9182:Nalcn UTSW 14 123,834,016 (GRCm39) missense probably damaging 1.00
R9193:Nalcn UTSW 14 123,545,792 (GRCm39) nonsense probably null
R9241:Nalcn UTSW 14 123,809,429 (GRCm39) missense probably benign 0.00
R9267:Nalcn UTSW 14 123,518,567 (GRCm39) missense probably benign 0.08
R9274:Nalcn UTSW 14 123,753,068 (GRCm39) missense probably damaging 1.00
R9277:Nalcn UTSW 14 123,518,523 (GRCm39) missense probably damaging 0.98
R9376:Nalcn UTSW 14 123,515,713 (GRCm39) missense possibly damaging 0.74
X0060:Nalcn UTSW 14 123,522,653 (GRCm39) missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123,831,980 (GRCm39) missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123,531,857 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGCTCATCCCATTATAAGTTCC -3'
(R):5'- GTCCTCAGCTGAACATTTTAGGC -3'

Sequencing Primer
(F):5'- ATAGATGGCAACCAGTGG -3'
(R):5'- CTATAGACAGTTGCAAGCTGCTG -3'
Posted On 2019-05-13