Incidental Mutation 'R7018:Krt1'
ID 545468
Institutional Source Beutler Lab
Gene Symbol Krt1
Ensembl Gene ENSMUSG00000046834
Gene Name keratin 1
Synonyms Krt2-1, Krt-2.1
MMRRC Submission 045119-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.454) question?
Stock # R7018 (G1)
Quality Score 214.458
Status Validated
Chromosome 15
Chromosomal Location 101753861-101759221 bp(-) (GRCm39)
Type of Mutation small deletion (10 aa in frame mutation)
DNA Base Change (assembly) AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC at 101758813 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023790]
AlphaFold P04104
Predicted Effect probably benign
Transcript: ENSMUST00000023790
SMART Domains Protein: ENSMUSP00000023790
Gene: ENSMUSG00000046834

DomainStartEndE-ValueType
Pfam:Keratin_2_head 19 184 7.5e-35 PFAM
Filament 187 500 1.02e-154 SMART
Pfam:Keratin_2_tail 501 633 7.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231047
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the spinous and granular layers of the epidermis with family member KRT10 and mutations in these genes have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a dominant mutation exhibit significant blistering and skin erosions at birth and develop severe hyperkeratosis as adults. Mice homozygous for the dominant mutation also exhibit blistering, and die before weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 63,070,120 (GRCm39) R129L probably damaging Het
Arhgef28 C T 13: 98,101,943 (GRCm39) V844I probably damaging Het
Arhgef5 T C 6: 43,265,665 (GRCm39) V1569A probably damaging Het
Atr T A 9: 95,748,747 (GRCm39) S431T probably benign Het
Cdh11 T C 8: 103,360,953 (GRCm39) D795G possibly damaging Het
Crygf T C 1: 65,967,130 (GRCm39) S85P probably benign Het
Dip2c T A 13: 9,709,314 (GRCm39) Y1385N probably damaging Het
Dnah14 G A 1: 181,454,509 (GRCm39) V840I possibly damaging Het
Dsg1a T C 18: 20,461,795 (GRCm39) F299L possibly damaging Het
Fgfr4 A T 13: 55,314,013 (GRCm39) S576C probably damaging Het
Frmd8 T C 19: 5,919,546 (GRCm39) D167G probably damaging Het
Gm5105 G A 3: 137,755,319 (GRCm39) T89I unknown Het
Grhl1 C T 12: 24,625,996 (GRCm39) S35L possibly damaging Het
Gsn A G 2: 35,183,518 (GRCm39) E242G probably benign Het
Hcrtr1 A G 4: 130,029,661 (GRCm39) I140T probably damaging Het
Ifnlr1 T C 4: 135,431,135 (GRCm39) Y208H possibly damaging Het
Ighv1-58 T C 12: 115,275,985 (GRCm39) Y51C probably damaging Het
Iqcj T A 3: 67,948,580 (GRCm39) Y21* probably null Het
Kcnc4 T C 3: 107,366,178 (GRCm39) Y10C probably benign Het
Kcnk7 G T 19: 5,756,160 (GRCm39) G129W probably damaging Het
Kcnq2 T A 2: 180,723,517 (GRCm39) R620* probably null Het
Klk13 C A 7: 43,376,126 (GRCm39) P267Q probably benign Het
L3mbtl4 G A 17: 68,793,938 (GRCm39) R314H probably damaging Het
Lamc2 T A 1: 153,012,488 (GRCm39) M729L probably benign Het
Lyst T G 13: 13,918,044 (GRCm39) probably null Het
Med13l G A 5: 118,890,051 (GRCm39) R1909H probably damaging Het
Mstn T A 1: 53,103,243 (GRCm39) L193Q possibly damaging Het
Mylk T C 16: 34,820,796 (GRCm39) V125A possibly damaging Het
Nalcn T A 14: 123,647,233 (GRCm39) M547L probably damaging Het
Nckap5 A G 1: 125,952,785 (GRCm39) S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 (GRCm38) Y189C probably damaging Het
Oosp3 T A 19: 11,676,783 (GRCm39) D47E probably benign Het
Or14j8 A T 17: 38,263,393 (GRCm39) I174N probably damaging Het
Or5d37 T A 2: 87,923,600 (GRCm39) I227F probably benign Het
Or5h25 A G 16: 58,930,970 (GRCm39) M1T probably null Het
Or5p66 T G 7: 107,885,551 (GRCm39) I261L probably benign Het
Pcdh15 G T 10: 74,302,186 (GRCm39) G942W probably damaging Het
Pcyox1l C A 18: 61,840,625 (GRCm39) probably benign Het
Peg3 T C 7: 6,711,838 (GRCm39) E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plscr1 T A 9: 92,146,715 (GRCm39) V119D probably damaging Het
Prss56 A T 1: 87,113,670 (GRCm39) D258V possibly damaging Het
Ptpn23 T G 9: 110,214,884 (GRCm39) K85Q possibly damaging Het
Ranbp3l C A 15: 9,037,159 (GRCm39) S7Y probably benign Het
Rnf31 T C 14: 55,829,690 (GRCm39) L85P probably damaging Het
Rptn T C 3: 93,305,207 (GRCm39) C847R possibly damaging Het
Six4 T A 12: 73,155,727 (GRCm39) E413D probably benign Het
Slc30a2 G A 4: 134,074,726 (GRCm39) R161Q probably damaging Het
Sned1 T C 1: 93,212,143 (GRCm39) V1115A probably damaging Het
Spen T C 4: 141,220,755 (GRCm39) K401E unknown Het
Srbd1 T A 17: 86,443,843 (GRCm39) R128W possibly damaging Het
Strc A T 2: 121,199,539 (GRCm39) I1300N probably damaging Het
Susd1 T G 4: 59,390,627 (GRCm39) T230P probably benign Het
Thumpd2 G T 17: 81,363,326 (GRCm39) S47* probably null Het
Tmprss11a C T 5: 86,576,429 (GRCm39) V141I probably damaging Het
Tmprss15 T C 16: 78,821,741 (GRCm39) Y438C possibly damaging Het
Tnfrsf1a T C 6: 125,333,914 (GRCm39) S56P probably damaging Het
Ttc39d T C 17: 80,523,610 (GRCm39) W90R probably benign Het
Utp25 A G 1: 192,797,163 (GRCm39) I563T probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Wdr20rt A T 12: 65,272,536 (GRCm39) probably null Het
Zfp646 C A 7: 127,481,494 (GRCm39) Q1224K probably benign Het
Other mutations in Krt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Krt1 APN 15 101,756,628 (GRCm39) missense probably damaging 1.00
IGL01478:Krt1 APN 15 101,754,721 (GRCm39) splice site probably benign
IGL01919:Krt1 APN 15 101,754,811 (GRCm39) missense unknown
IGL01970:Krt1 APN 15 101,755,299 (GRCm39) missense possibly damaging 0.95
IGL02207:Krt1 APN 15 101,757,051 (GRCm39) missense possibly damaging 0.94
IGL02643:Krt1 APN 15 101,755,479 (GRCm39) missense probably benign 0.26
R0445:Krt1 UTSW 15 101,756,056 (GRCm39) missense probably damaging 1.00
R0683:Krt1 UTSW 15 101,758,901 (GRCm39) missense unknown
R1006:Krt1 UTSW 15 101,756,326 (GRCm39) missense possibly damaging 0.96
R1163:Krt1 UTSW 15 101,756,600 (GRCm39) nonsense probably null
R1217:Krt1 UTSW 15 101,757,416 (GRCm39) missense possibly damaging 0.90
R1325:Krt1 UTSW 15 101,756,641 (GRCm39) splice site probably null
R1965:Krt1 UTSW 15 101,757,427 (GRCm39) missense probably benign 0.13
R1966:Krt1 UTSW 15 101,757,427 (GRCm39) missense probably benign 0.13
R2101:Krt1 UTSW 15 101,754,622 (GRCm39) missense unknown
R2302:Krt1 UTSW 15 101,754,622 (GRCm39) missense unknown
R2697:Krt1 UTSW 15 101,755,364 (GRCm39) missense probably damaging 1.00
R3034:Krt1 UTSW 15 101,759,068 (GRCm39) missense unknown
R3079:Krt1 UTSW 15 101,754,622 (GRCm39) missense unknown
R3080:Krt1 UTSW 15 101,754,622 (GRCm39) missense unknown
R3891:Krt1 UTSW 15 101,758,847 (GRCm39) missense unknown
R3892:Krt1 UTSW 15 101,758,847 (GRCm39) missense unknown
R4180:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R4305:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R4334:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R4597:Krt1 UTSW 15 101,756,063 (GRCm39) missense possibly damaging 0.90
R4625:Krt1 UTSW 15 101,754,622 (GRCm39) missense unknown
R4626:Krt1 UTSW 15 101,754,622 (GRCm39) missense unknown
R4628:Krt1 UTSW 15 101,754,622 (GRCm39) missense unknown
R4629:Krt1 UTSW 15 101,754,622 (GRCm39) missense unknown
R4630:Krt1 UTSW 15 101,754,622 (GRCm39) missense unknown
R4631:Krt1 UTSW 15 101,754,622 (GRCm39) missense unknown
R4632:Krt1 UTSW 15 101,754,622 (GRCm39) missense unknown
R4633:Krt1 UTSW 15 101,754,622 (GRCm39) missense unknown
R4893:Krt1 UTSW 15 101,758,555 (GRCm39) missense probably damaging 1.00
R4948:Krt1 UTSW 15 101,754,376 (GRCm39) missense unknown
R5193:Krt1 UTSW 15 101,754,357 (GRCm39) missense unknown
R5254:Krt1 UTSW 15 101,754,803 (GRCm39) missense unknown
R5448:Krt1 UTSW 15 101,757,464 (GRCm39) nonsense probably null
R5494:Krt1 UTSW 15 101,759,149 (GRCm39) missense unknown
R5567:Krt1 UTSW 15 101,755,340 (GRCm39) missense probably benign 0.12
R5570:Krt1 UTSW 15 101,755,340 (GRCm39) missense probably benign 0.12
R5869:Krt1 UTSW 15 101,758,566 (GRCm39) missense probably damaging 1.00
R6200:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R6224:Krt1 UTSW 15 101,758,702 (GRCm39) missense possibly damaging 0.92
R6326:Krt1 UTSW 15 101,758,684 (GRCm39) missense probably damaging 1.00
R6517:Krt1 UTSW 15 101,758,702 (GRCm39) missense possibly damaging 0.92
R6525:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R6918:Krt1 UTSW 15 101,758,612 (GRCm39) missense probably damaging 1.00
R7040:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R7110:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R7296:Krt1 UTSW 15 101,759,064 (GRCm39) missense unknown
R7368:Krt1 UTSW 15 101,755,307 (GRCm39) missense probably damaging 1.00
R7549:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R7706:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R8416:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R8418:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R8842:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R8914:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R8964:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R8979:Krt1 UTSW 15 101,755,340 (GRCm39) missense probably benign 0.12
R8988:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R9134:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R9248:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R9380:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R9404:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R9430:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R9638:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
R9768:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
RF003:Krt1 UTSW 15 101,758,813 (GRCm39) small deletion probably benign
X0067:Krt1 UTSW 15 101,756,190 (GRCm39) critical splice donor site probably null
Z1177:Krt1 UTSW 15 101,758,970 (GRCm39) missense unknown
Z1177:Krt1 UTSW 15 101,754,451 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TCAACGTTGAGGGGTTGCAG -3'
(R):5'- CAGATCCACCAGCAGCTCTATG -3'

Sequencing Primer
(F):5'- CAGAAGGCTTTGGTTGATGGTCAC -3'
(R):5'- AGATTTTCAGGAGGAGGCTTC -3'
Posted On 2019-05-13