Incidental Mutation 'R7018:Tmprss15'
ID545471
Institutional Source Beutler Lab
Gene Symbol Tmprss15
Ensembl Gene ENSMUSG00000022857
Gene Nametransmembrane protease, serine 15
SynonymsA130097D21Rik, enterokinase, enteropeptidase, Prss7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7018 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location78953008-79091097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79024853 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 438 (Y438C)
Ref Sequence ENSEMBL: ENSMUSP00000023566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023566] [ENSMUST00000060402]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023566
AA Change: Y438C

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023566
Gene: ENSMUSG00000022857
AA Change: Y438C

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 228 268 1.74e-4 SMART
CUB 270 379 1.54e-11 SMART
MAM 387 549 7.33e-54 SMART
low complexity region 551 567 N/A INTRINSIC
CUB 569 679 1.72e-32 SMART
LDLa 687 724 7.32e-12 SMART
SR 723 813 3.12e-5 SMART
Tryp_SPc 829 1064 1.48e-95 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000060402
AA Change: Y423C

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052034
Gene: ENSMUSG00000022857
AA Change: Y423C

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 213 253 1.74e-4 SMART
CUB 255 364 1.54e-11 SMART
MAM 372 534 7.33e-54 SMART
low complexity region 536 552 N/A INTRINSIC
CUB 554 664 1.72e-32 SMART
LDLa 672 709 7.32e-12 SMART
SR 708 798 3.12e-5 SMART
Tryp_SPc 814 1049 1.48e-95 SMART
Meta Mutation Damage Score 0.8994 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes an enzyme that proteolytically activates the pancreatic proenzyme trypsinogen, converting it into trypsin. The encoded protein is cleaved into two chains that form a heterodimer linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 62,937,049 R129L probably damaging Het
Arhgef28 C T 13: 97,965,435 V844I probably damaging Het
Arhgef5 T C 6: 43,288,731 V1569A probably damaging Het
Atr T A 9: 95,866,694 S431T probably benign Het
Cdh11 T C 8: 102,634,321 D795G possibly damaging Het
Crygf T C 1: 65,927,971 S85P probably benign Het
Diexf A G 1: 193,114,855 I563T probably benign Het
Dip2c T A 13: 9,659,278 Y1385N probably damaging Het
Dnah14 G A 1: 181,626,944 V840I possibly damaging Het
Dsg1a T C 18: 20,328,738 F299L possibly damaging Het
Fgfr4 A T 13: 55,166,200 S576C probably damaging Het
Frmd8 T C 19: 5,869,518 D167G probably damaging Het
Gm5105 G A 3: 138,049,558 T89I unknown Het
Grhl1 C T 12: 24,575,997 S35L possibly damaging Het
Gsn A G 2: 35,293,506 E242G probably benign Het
Hcrtr1 A G 4: 130,135,868 I140T probably damaging Het
Ifnlr1 T C 4: 135,703,824 Y208H possibly damaging Het
Ighv1-58 T C 12: 115,312,365 Y51C probably damaging Het
Iqcj T A 3: 68,041,247 Y21* probably null Het
Kcnc4 T C 3: 107,458,862 Y10C probably benign Het
Kcnk7 G T 19: 5,706,132 G129W probably damaging Het
Kcnq2 T A 2: 181,081,724 R620* probably null Het
Klk13 C A 7: 43,726,702 P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
L3mbtl4 G A 17: 68,486,943 R314H probably damaging Het
Lamc2 T A 1: 153,136,742 M729L probably benign Het
Lyst T G 13: 13,743,459 probably null Het
Med13l G A 5: 118,751,986 R1909H probably damaging Het
Mstn T A 1: 53,064,084 L193Q possibly damaging Het
Mylk T C 16: 35,000,426 V125A possibly damaging Het
Nalcn T A 14: 123,409,821 M547L probably damaging Het
Nckap5 A G 1: 126,025,048 S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 Y189C probably damaging Het
Olfr1164 T A 2: 88,093,256 I227F probably benign Het
Olfr193 A G 16: 59,110,607 M1T probably null Het
Olfr490 T G 7: 108,286,344 I261L probably benign Het
Olfr761 A T 17: 37,952,502 I174N probably damaging Het
Oosp3 T A 19: 11,699,419 D47E probably benign Het
Pcdh15 G T 10: 74,466,354 G942W probably damaging Het
Pcyox1l C A 18: 61,707,554 probably benign Het
Peg3 T C 7: 6,708,839 E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plscr1 T A 9: 92,264,662 V119D probably damaging Het
Prss56 A T 1: 87,185,948 D258V possibly damaging Het
Ptpn23 T G 9: 110,385,816 K85Q possibly damaging Het
Ranbp3l C A 15: 9,007,285 S7Y probably benign Het
Rnf31 T C 14: 55,592,233 L85P probably damaging Het
Rptn T C 3: 93,397,900 C847R possibly damaging Het
Six4 T A 12: 73,108,953 E413D probably benign Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Sned1 T C 1: 93,284,421 V1115A probably damaging Het
Spen T C 4: 141,493,444 K401E unknown Het
Srbd1 T A 17: 86,136,415 R128W possibly damaging Het
Strc A T 2: 121,369,058 I1300N probably damaging Het
Susd1 T G 4: 59,390,627 T230P probably benign Het
Thumpd2 G T 17: 81,055,897 S47* probably null Het
Tmprss11a C T 5: 86,428,570 V141I probably damaging Het
Tnfrsf1a T C 6: 125,356,951 S56P probably damaging Het
Ttc39d T C 17: 80,216,181 W90R probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20rt A T 12: 65,225,762 probably null Het
Zfp646 C A 7: 127,882,322 Q1224K probably benign Het
Other mutations in Tmprss15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Tmprss15 APN 16 78985994 missense possibly damaging 0.87
IGL00477:Tmprss15 APN 16 79021413 missense probably damaging 1.00
IGL01583:Tmprss15 APN 16 79071261 missense probably benign
IGL01896:Tmprss15 APN 16 79090790 missense probably benign 0.22
IGL02052:Tmprss15 APN 16 79087506 missense probably damaging 1.00
IGL02374:Tmprss15 APN 16 79035168 missense probably benign 0.00
IGL02505:Tmprss15 APN 16 78987741 missense probably benign 0.00
IGL02632:Tmprss15 APN 16 78985902 missense probably damaging 0.98
IGL02674:Tmprss15 APN 16 79001794 missense possibly damaging 0.72
PIT1430001:Tmprss15 UTSW 16 79024752 critical splice donor site probably null
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0195:Tmprss15 UTSW 16 79034334 missense probably benign 0.05
R0335:Tmprss15 UTSW 16 79024742 splice site probably benign
R0514:Tmprss15 UTSW 16 78968267 missense probably benign 0.05
R0552:Tmprss15 UTSW 16 79024749 splice site probably null
R0675:Tmprss15 UTSW 16 78985950 missense probably damaging 0.98
R0739:Tmprss15 UTSW 16 79024848 missense possibly damaging 0.62
R1435:Tmprss15 UTSW 16 79021454 missense probably benign 0.03
R1446:Tmprss15 UTSW 16 79078958 missense probably benign 0.01
R1572:Tmprss15 UTSW 16 79090829 missense probably benign 0.00
R1708:Tmprss15 UTSW 16 79054070 missense possibly damaging 0.95
R1893:Tmprss15 UTSW 16 79071418 missense probably benign
R2403:Tmprss15 UTSW 16 79057690 missense probably damaging 1.00
R2866:Tmprss15 UTSW 16 79035233 missense possibly damaging 0.65
R2913:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R2914:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R3425:Tmprss15 UTSW 16 79003433 missense possibly damaging 0.83
R3703:Tmprss15 UTSW 16 79054142 critical splice acceptor site probably null
R3916:Tmprss15 UTSW 16 78985996 missense probably damaging 1.00
R3950:Tmprss15 UTSW 16 79073186 missense probably benign 0.04
R4332:Tmprss15 UTSW 16 79034334 missense probably benign 0.15
R4392:Tmprss15 UTSW 16 79024438 missense probably damaging 1.00
R4515:Tmprss15 UTSW 16 78957356 missense probably benign 0.00
R4619:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4620:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4754:Tmprss15 UTSW 16 79054124 missense probably damaging 0.98
R4853:Tmprss15 UTSW 16 78960591 missense probably benign
R5159:Tmprss15 UTSW 16 79003410 missense probably benign 0.26
R5441:Tmprss15 UTSW 16 79071447 critical splice acceptor site probably null
R5824:Tmprss15 UTSW 16 79034313 missense probably damaging 0.99
R5970:Tmprss15 UTSW 16 79057659 missense probably benign 0.00
R6224:Tmprss15 UTSW 16 79024378 missense probably benign 0.08
R6257:Tmprss15 UTSW 16 78972225 missense probably damaging 1.00
R6313:Tmprss15 UTSW 16 78962170 missense probably benign 0.16
R6368:Tmprss15 UTSW 16 79006057 intron probably null
R6525:Tmprss15 UTSW 16 79003378 missense probably damaging 0.97
R6587:Tmprss15 UTSW 16 79071429 missense probably benign
R6894:Tmprss15 UTSW 16 79075814 nonsense probably null
R7180:Tmprss15 UTSW 16 78967998 missense probably damaging 0.97
R7324:Tmprss15 UTSW 16 78962019 missense probably damaging 1.00
R7337:Tmprss15 UTSW 16 79071276 missense probably benign 0.01
R7558:Tmprss15 UTSW 16 79003414 missense possibly damaging 0.55
R7732:Tmprss15 UTSW 16 79003420 missense probably benign 0.11
R7792:Tmprss15 UTSW 16 79003387 missense probably damaging 1.00
R7829:Tmprss15 UTSW 16 78987650 missense probably benign 0.02
R7998:Tmprss15 UTSW 16 79001843 missense possibly damaging 0.79
R8009:Tmprss15 UTSW 16 79090863 missense probably damaging 0.96
RF005:Tmprss15 UTSW 16 78953801 makesense probably null
Predicted Primers PCR Primer
(F):5'- CCTAAACATTTACAGAGACGGC -3'
(R):5'- GCTGATTATCTGTCAAGCTGTG -3'

Sequencing Primer
(F):5'- GAGACGGCATTTAAATATTTCCTACC -3'
(R):5'- CTGTCAAGCTGTGAATTCATCAAG -3'
Posted On2019-05-13