Mutagenetix > Incidental Mutation

Incidental Mutation 'R7018:Dsg1a'

545478

Institutional Source

Beutler Lab

Gene Symbol

Dsg1a

Ensembl Gene

ENSMUSG00000069441

Gene Name

desmoglein 1 alpha

Synonyms

Dsg1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R7018 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20310811-20343350 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20328738 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 299 (F299L)

Ref Sequence

ENSEMBL: ENSMUSP00000076393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077146]

AlphaFold

Q61495

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077146
AA Change: F299L

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000076393
Gene: ENSMUSG00000069441
AA Change: F299L

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	70	155	3.45e-14	SMART
CA	179	267	3.11e-21	SMART
CA	290	384	6.29e-8	SMART
CA	407	485	6.44e-1	SMART
low complexity region	573	584	N/A	INTRINSIC
low complexity region	590	598	N/A	INTRINSIC
Pfam:Cadherin_C	659	781	1.6e-10	PFAM
low complexity region	786	799	N/A	INTRINSIC
internal_repeat_1	823	888	9.56e-6	PROSPERO
internal_repeat_1	908	975	9.56e-6	PROSPERO
low complexity region	983	1004	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apcdd1	G	T	18: 62,937,049	R129L	probably damaging	Het
Arhgef28	C	T	13: 97,965,435	V844I	probably damaging	Het
Arhgef5	T	C	6: 43,288,731	V1569A	probably damaging	Het
Atr	T	A	9: 95,866,694	S431T	probably benign	Het
Cdh11	T	C	8: 102,634,321	D795G	possibly damaging	Het
Crygf	T	C	1: 65,927,971	S85P	probably benign	Het
Diexf	A	G	1: 193,114,855	I563T	probably benign	Het
Dip2c	T	A	13: 9,659,278	Y1385N	probably damaging	Het
Dnah14	G	A	1: 181,626,944	V840I	possibly damaging	Het
Fgfr4	A	T	13: 55,166,200	S576C	probably damaging	Het
Frmd8	T	C	19: 5,869,518	D167G	probably damaging	Het
Gm5105	G	A	3: 138,049,558	T89I	unknown	Het
Grhl1	C	T	12: 24,575,997	S35L	possibly damaging	Het
Gsn	A	G	2: 35,293,506	E242G	probably benign	Het
Hcrtr1	A	G	4: 130,135,868	I140T	probably damaging	Het
Ifnlr1	T	C	4: 135,703,824	Y208H	possibly damaging	Het
Ighv1-58	T	C	12: 115,312,365	Y51C	probably damaging	Het
Iqcj	T	A	3: 68,041,247	Y21*	probably null	Het
Kcnc4	T	C	3: 107,458,862	Y10C	probably benign	Het
Kcnk7	G	T	19: 5,706,132	G129W	probably damaging	Het
Kcnq2	T	A	2: 181,081,724	R620*	probably null	Het
Klk13	C	A	7: 43,726,702	P267Q	probably benign	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
L3mbtl4	G	A	17: 68,486,943	R314H	probably damaging	Het
Lamc2	T	A	1: 153,136,742	M729L	probably benign	Het
Lyst	T	G	13: 13,743,459		probably null	Het
Med13l	G	A	5: 118,751,986	R1909H	probably damaging	Het
Mstn	T	A	1: 53,064,084	L193Q	possibly damaging	Het
Mylk	T	C	16: 35,000,426	V125A	possibly damaging	Het
Nalcn	T	A	14: 123,409,821	M547L	probably damaging	Het
Nckap5	A	G	1: 126,025,048	S1256P	probably damaging	Het
Nkain1	T	C	4: 130,532,118	Y189C	probably damaging	Het
Olfr1164	T	A	2: 88,093,256	I227F	probably benign	Het
Olfr193	A	G	16: 59,110,607	M1T	probably null	Het
Olfr490	T	G	7: 108,286,344	I261L	probably benign	Het
Olfr761	A	T	17: 37,952,502	I174N	probably damaging	Het
Oosp3	T	A	19: 11,699,419	D47E	probably benign	Het
Pcdh15	G	T	10: 74,466,354	G942W	probably damaging	Het
Pcyox1l	C	A	18: 61,707,554		probably benign	Het
Peg3	T	C	7: 6,708,839	E1128G	possibly damaging	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Plscr1	T	A	9: 92,264,662	V119D	probably damaging	Het
Prss56	A	T	1: 87,185,948	D258V	possibly damaging	Het
Ptpn23	T	G	9: 110,385,816	K85Q	possibly damaging	Het
Ranbp3l	C	A	15: 9,007,285	S7Y	probably benign	Het
Rnf31	T	C	14: 55,592,233	L85P	probably damaging	Het
Rptn	T	C	3: 93,397,900	C847R	possibly damaging	Het
Six4	T	A	12: 73,108,953	E413D	probably benign	Het
Slc30a2	G	A	4: 134,347,415	R161Q	probably damaging	Het
Sned1	T	C	1: 93,284,421	V1115A	probably damaging	Het
Spen	T	C	4: 141,493,444	K401E	unknown	Het
Srbd1	T	A	17: 86,136,415	R128W	possibly damaging	Het
Strc	A	T	2: 121,369,058	I1300N	probably damaging	Het
Susd1	T	G	4: 59,390,627	T230P	probably benign	Het
Thumpd2	G	T	17: 81,055,897	S47*	probably null	Het
Tmprss11a	C	T	5: 86,428,570	V141I	probably damaging	Het
Tmprss15	T	C	16: 79,024,853	Y438C	possibly damaging	Het
Tnfrsf1a	T	C	6: 125,356,951	S56P	probably damaging	Het
Ttc39d	T	C	17: 80,216,181	W90R	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Wdr20rt	A	T	12: 65,225,762		probably null	Het
Zfp646	C	A	7: 127,882,322	Q1224K	probably benign	Het

Other mutations in Dsg1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01064:Dsg1a	APN	18	20340206	missense	probably damaging	1.00
IGL01148:Dsg1a	APN	18	20320925	missense	probably damaging	0.97
IGL01534:Dsg1a	APN	18	20340996	missense	probably benign	0.06
IGL01566:Dsg1a	APN	18	20336783	splice site	probably benign
IGL01582:Dsg1a	APN	18	20328848	missense	probably null	1.00
IGL01913:Dsg1a	APN	18	20322236	missense	probably damaging	1.00
IGL01926:Dsg1a	APN	18	20333584	missense	possibly damaging	0.60
IGL02102:Dsg1a	APN	18	20332032	missense	probably benign	0.01
IGL02900:Dsg1a	APN	18	20328656	splice site	probably benign
IGL02937:Dsg1a	APN	18	20331534	missense	possibly damaging	0.93
IGL02962:Dsg1a	APN	18	20340324	missense	possibly damaging	0.92
IGL03003:Dsg1a	APN	18	20336819	missense	probably benign	0.43
PIT4687001:Dsg1a	UTSW	18	20331698	missense	probably benign	0.16
R0126:Dsg1a	UTSW	18	20340878	missense	probably benign	0.00
R0200:Dsg1a	UTSW	18	20340938	missense	probably benign	0.00
R0284:Dsg1a	UTSW	18	20331627	missense	probably damaging	0.98
R0394:Dsg1a	UTSW	18	20333750	missense	probably damaging	1.00
R0543:Dsg1a	UTSW	18	20340863	missense	probably damaging	1.00
R0656:Dsg1a	UTSW	18	20335892	splice site	probably benign
R0733:Dsg1a	UTSW	18	20338668	missense	probably damaging	0.97
R0750:Dsg1a	UTSW	18	20340153	missense	probably benign	0.10
R1300:Dsg1a	UTSW	18	20332149	missense	probably benign	0.19
R1501:Dsg1a	UTSW	18	20332019	missense	probably damaging	1.00
R1523:Dsg1a	UTSW	18	20322317	missense	probably damaging	0.99
R1673:Dsg1a	UTSW	18	20331504	missense	probably damaging	1.00
R1980:Dsg1a	UTSW	18	20338650	missense	probably damaging	1.00
R2102:Dsg1a	UTSW	18	20333773	missense	probably damaging	1.00
R2132:Dsg1a	UTSW	18	20340797	missense	probably damaging	1.00
R2299:Dsg1a	UTSW	18	20340150	missense	probably damaging	1.00
R2426:Dsg1a	UTSW	18	20336804	missense	probably damaging	0.96
R3031:Dsg1a	UTSW	18	20340492	missense	probably damaging	1.00
R4044:Dsg1a	UTSW	18	20324030	missense	probably damaging	1.00
R4075:Dsg1a	UTSW	18	20340070	missense	possibly damaging	0.53
R4644:Dsg1a	UTSW	18	20340728	missense	probably benign	0.04
R4661:Dsg1a	UTSW	18	20340533	missense	probably damaging	0.99
R4816:Dsg1a	UTSW	18	20333722	missense	probably benign	0.10
R5221:Dsg1a	UTSW	18	20324014	missense	possibly damaging	0.64
R5257:Dsg1a	UTSW	18	20320931	missense	probably damaging	1.00
R5360:Dsg1a	UTSW	18	20340954	missense	probably damaging	0.96
R5547:Dsg1a	UTSW	18	20336040	critical splice donor site	probably null
R5702:Dsg1a	UTSW	18	20336865	critical splice donor site	probably null
R5987:Dsg1a	UTSW	18	20331542	missense	probably damaging	1.00
R6108:Dsg1a	UTSW	18	20340247	missense	probably benign	0.19
R6170:Dsg1a	UTSW	18	20335986	missense	probably damaging	0.99
R7201:Dsg1a	UTSW	18	20328311	missense	probably damaging	0.98
R7730:Dsg1a	UTSW	18	20331711	missense	possibly damaging	0.77
R7814:Dsg1a	UTSW	18	20338515	splice site	probably null
R8185:Dsg1a	UTSW	18	20340612	missense	probably damaging	1.00
R8297:Dsg1a	UTSW	18	20332033	missense	probably benign	0.02
R8377:Dsg1a	UTSW	18	20333774	missense	probably damaging	1.00
R8409:Dsg1a	UTSW	18	20340151	missense	probably damaging	1.00
R8775:Dsg1a	UTSW	18	20340507	missense	probably damaging	0.98
R8775-TAIL:Dsg1a	UTSW	18	20340507	missense	probably damaging	0.98
R8818:Dsg1a	UTSW	18	20340542	missense	possibly damaging	0.87
R8821:Dsg1a	UTSW	18	20320308	missense	probably damaging	0.96
R8831:Dsg1a	UTSW	18	20320308	missense	probably damaging	0.96
R9030:Dsg1a	UTSW	18	20340492	missense	probably damaging	1.00
R9205:Dsg1a	UTSW	18	20340171	missense	probably damaging	1.00
R9239:Dsg1a	UTSW	18	20340693	missense	probably damaging	1.00
R9410:Dsg1a	UTSW	18	20331533	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- GCTTTCACAGTGGGAAAAGTG -3'
(R):5'- TGCTTTCCCCAAACCTGATG -3'

Sequencing Primer
(F):5'- TGCAATTATAAGCAGGGATGTTG -3'
(R):5'- TTTGAATGCTTATTATCCTGAG -3'

Posted On

2019-05-13