Incidental Mutation 'R7018:Apcdd1'
ID 545480
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Name adenomatosis polyposis coli down-regulated 1
Synonyms Drapc1, EIG180
MMRRC Submission 045119-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.109) question?
Stock # R7018 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 63055398-63086886 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 63070120 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 129 (R129L)
Ref Sequence ENSEMBL: ENSMUSP00000125868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
AlphaFold Q3U128
Predicted Effect probably damaging
Transcript: ENSMUST00000096554
AA Change: R129L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: R129L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163716
AA Change: R129L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: R129L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 C T 13: 98,101,943 (GRCm39) V844I probably damaging Het
Arhgef5 T C 6: 43,265,665 (GRCm39) V1569A probably damaging Het
Atr T A 9: 95,748,747 (GRCm39) S431T probably benign Het
Cdh11 T C 8: 103,360,953 (GRCm39) D795G possibly damaging Het
Crygf T C 1: 65,967,130 (GRCm39) S85P probably benign Het
Dip2c T A 13: 9,709,314 (GRCm39) Y1385N probably damaging Het
Dnah14 G A 1: 181,454,509 (GRCm39) V840I possibly damaging Het
Dsg1a T C 18: 20,461,795 (GRCm39) F299L possibly damaging Het
Fgfr4 A T 13: 55,314,013 (GRCm39) S576C probably damaging Het
Frmd8 T C 19: 5,919,546 (GRCm39) D167G probably damaging Het
Gm5105 G A 3: 137,755,319 (GRCm39) T89I unknown Het
Grhl1 C T 12: 24,625,996 (GRCm39) S35L possibly damaging Het
Gsn A G 2: 35,183,518 (GRCm39) E242G probably benign Het
Hcrtr1 A G 4: 130,029,661 (GRCm39) I140T probably damaging Het
Ifnlr1 T C 4: 135,431,135 (GRCm39) Y208H possibly damaging Het
Ighv1-58 T C 12: 115,275,985 (GRCm39) Y51C probably damaging Het
Iqcj T A 3: 67,948,580 (GRCm39) Y21* probably null Het
Kcnc4 T C 3: 107,366,178 (GRCm39) Y10C probably benign Het
Kcnk7 G T 19: 5,756,160 (GRCm39) G129W probably damaging Het
Kcnq2 T A 2: 180,723,517 (GRCm39) R620* probably null Het
Klk13 C A 7: 43,376,126 (GRCm39) P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
L3mbtl4 G A 17: 68,793,938 (GRCm39) R314H probably damaging Het
Lamc2 T A 1: 153,012,488 (GRCm39) M729L probably benign Het
Lyst T G 13: 13,918,044 (GRCm39) probably null Het
Med13l G A 5: 118,890,051 (GRCm39) R1909H probably damaging Het
Mstn T A 1: 53,103,243 (GRCm39) L193Q possibly damaging Het
Mylk T C 16: 34,820,796 (GRCm39) V125A possibly damaging Het
Nalcn T A 14: 123,647,233 (GRCm39) M547L probably damaging Het
Nckap5 A G 1: 125,952,785 (GRCm39) S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 (GRCm38) Y189C probably damaging Het
Oosp3 T A 19: 11,676,783 (GRCm39) D47E probably benign Het
Or14j8 A T 17: 38,263,393 (GRCm39) I174N probably damaging Het
Or5d37 T A 2: 87,923,600 (GRCm39) I227F probably benign Het
Or5h25 A G 16: 58,930,970 (GRCm39) M1T probably null Het
Or5p66 T G 7: 107,885,551 (GRCm39) I261L probably benign Het
Pcdh15 G T 10: 74,302,186 (GRCm39) G942W probably damaging Het
Pcyox1l C A 18: 61,840,625 (GRCm39) probably benign Het
Peg3 T C 7: 6,711,838 (GRCm39) E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plscr1 T A 9: 92,146,715 (GRCm39) V119D probably damaging Het
Prss56 A T 1: 87,113,670 (GRCm39) D258V possibly damaging Het
Ptpn23 T G 9: 110,214,884 (GRCm39) K85Q possibly damaging Het
Ranbp3l C A 15: 9,037,159 (GRCm39) S7Y probably benign Het
Rnf31 T C 14: 55,829,690 (GRCm39) L85P probably damaging Het
Rptn T C 3: 93,305,207 (GRCm39) C847R possibly damaging Het
Six4 T A 12: 73,155,727 (GRCm39) E413D probably benign Het
Slc30a2 G A 4: 134,074,726 (GRCm39) R161Q probably damaging Het
Sned1 T C 1: 93,212,143 (GRCm39) V1115A probably damaging Het
Spen T C 4: 141,220,755 (GRCm39) K401E unknown Het
Srbd1 T A 17: 86,443,843 (GRCm39) R128W possibly damaging Het
Strc A T 2: 121,199,539 (GRCm39) I1300N probably damaging Het
Susd1 T G 4: 59,390,627 (GRCm39) T230P probably benign Het
Thumpd2 G T 17: 81,363,326 (GRCm39) S47* probably null Het
Tmprss11a C T 5: 86,576,429 (GRCm39) V141I probably damaging Het
Tmprss15 T C 16: 78,821,741 (GRCm39) Y438C possibly damaging Het
Tnfrsf1a T C 6: 125,333,914 (GRCm39) S56P probably damaging Het
Ttc39d T C 17: 80,523,610 (GRCm39) W90R probably benign Het
Utp25 A G 1: 192,797,163 (GRCm39) I563T probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Wdr20rt A T 12: 65,272,536 (GRCm39) probably null Het
Zfp646 C A 7: 127,481,494 (GRCm39) Q1224K probably benign Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 63,066,936 (GRCm39) splice site probably benign
IGL01522:Apcdd1 APN 18 63,085,186 (GRCm39) missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 63,070,357 (GRCm39) missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 63,083,054 (GRCm39) missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 63,084,925 (GRCm39) missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 63,083,259 (GRCm39) missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 63,084,891 (GRCm39) splice site probably benign
R0207:Apcdd1 UTSW 18 63,083,150 (GRCm39) missense probably benign 0.04
R0363:Apcdd1 UTSW 18 63,070,168 (GRCm39) missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 63,084,967 (GRCm39) missense possibly damaging 0.82
R0567:Apcdd1 UTSW 18 63,067,107 (GRCm39) missense possibly damaging 0.93
R0607:Apcdd1 UTSW 18 63,084,967 (GRCm39) missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 63,067,041 (GRCm39) missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 63,085,095 (GRCm39) missense probably benign
R1178:Apcdd1 UTSW 18 63,070,168 (GRCm39) missense probably damaging 1.00
R1180:Apcdd1 UTSW 18 63,070,168 (GRCm39) missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 63,070,168 (GRCm39) missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 63,085,003 (GRCm39) missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 63,070,105 (GRCm39) missense probably benign 0.01
R5622:Apcdd1 UTSW 18 63,069,973 (GRCm39) splice site probably null
R5771:Apcdd1 UTSW 18 63,070,027 (GRCm39) missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 63,070,134 (GRCm39) missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 63,084,940 (GRCm39) missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 63,070,437 (GRCm39) missense probably damaging 1.00
R6515:Apcdd1 UTSW 18 63,084,910 (GRCm39) missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 63,084,929 (GRCm39) missense probably damaging 1.00
R6831:Apcdd1 UTSW 18 63,083,197 (GRCm39) nonsense probably null
R6931:Apcdd1 UTSW 18 63,066,979 (GRCm39) missense probably damaging 1.00
R7115:Apcdd1 UTSW 18 63,070,024 (GRCm39) missense probably damaging 1.00
R7148:Apcdd1 UTSW 18 63,084,916 (GRCm39) missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 63,085,259 (GRCm39) nonsense probably null
R8025:Apcdd1 UTSW 18 63,069,979 (GRCm39) missense probably damaging 1.00
R8114:Apcdd1 UTSW 18 63,083,127 (GRCm39) missense probably damaging 1.00
R8261:Apcdd1 UTSW 18 63,066,974 (GRCm39) missense possibly damaging 0.86
R8404:Apcdd1 UTSW 18 63,066,986 (GRCm39) missense possibly damaging 0.66
R9015:Apcdd1 UTSW 18 63,083,157 (GRCm39) missense possibly damaging 0.93
R9040:Apcdd1 UTSW 18 63,070,414 (GRCm39) missense probably damaging 0.96
R9288:Apcdd1 UTSW 18 63,055,731 (GRCm39) start gained probably benign
R9295:Apcdd1 UTSW 18 63,055,731 (GRCm39) start gained probably benign
R9297:Apcdd1 UTSW 18 63,055,731 (GRCm39) start gained probably benign
R9317:Apcdd1 UTSW 18 63,055,731 (GRCm39) start gained probably benign
R9319:Apcdd1 UTSW 18 63,055,731 (GRCm39) start gained probably benign
R9393:Apcdd1 UTSW 18 63,055,731 (GRCm39) start gained probably benign
R9394:Apcdd1 UTSW 18 63,055,731 (GRCm39) start gained probably benign
R9396:Apcdd1 UTSW 18 63,055,731 (GRCm39) start gained probably benign
R9397:Apcdd1 UTSW 18 63,055,731 (GRCm39) start gained probably benign
R9480:Apcdd1 UTSW 18 63,055,731 (GRCm39) start gained probably benign
R9520:Apcdd1 UTSW 18 63,083,190 (GRCm39) missense possibly damaging 0.85
R9521:Apcdd1 UTSW 18 63,055,731 (GRCm39) start gained probably benign
R9599:Apcdd1 UTSW 18 63,083,269 (GRCm39) critical splice donor site probably null
X0028:Apcdd1 UTSW 18 63,070,201 (GRCm39) missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 63,070,254 (GRCm39) missense probably benign 0.18
Z1177:Apcdd1 UTSW 18 63,055,762 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACACGCTGTTGGCTTTATCTAG -3'
(R):5'- TGGTGCACTCGTGGTTACTC -3'

Sequencing Primer
(F):5'- GCTGTTGGCTTTATCTAGCTCTTC -3'
(R):5'- CAGGTCATAGGCTACGTCCTGTAC -3'
Posted On 2019-05-13