Incidental Mutation 'R7019:Itih5'
ID 545487
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha (globulin) inhibitor H5
Synonyms 5430408M01Rik, 4631408O11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R7019 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 10153571-10256529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 10190327 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 177 (R177S)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect probably damaging
Transcript: ENSMUST00000026886
AA Change: R177S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: R177S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A T 16: 8,618,531 K414* probably null Het
Aco1 T A 4: 40,186,376 I596N probably damaging Het
Adgre1 A C 17: 57,410,945 D319A probably damaging Het
BC067074 C T 13: 113,351,750 T102I probably benign Het
Birc6 T C 17: 74,609,345 V445A probably benign Het
Btd A C 14: 31,667,105 Q261P probably damaging Het
Btd G T 14: 31,667,106 Q261H possibly damaging Het
C7 T A 15: 5,045,682 Y176F probably benign Het
Ccdc102a T C 8: 94,909,803 S287G probably benign Het
Ccdc178 T A 18: 22,150,438 T12S probably benign Het
Cnga4 G T 7: 105,405,829 A104S probably benign Het
Col10a1 G T 10: 34,394,951 L306F probably damaging Het
Cpne5 T C 17: 29,226,222 D36G probably damaging Het
Csmd2 G A 4: 128,369,063 D681N Het
Cstl1 A G 2: 148,755,303 M75V probably benign Het
Cyp26a1 T C 19: 37,698,812 L149P probably damaging Het
D630045J12Rik T G 6: 38,194,635 E866A probably benign Het
Dlec1 C T 9: 119,112,422 P292L probably benign Het
Dpp3 T G 19: 4,916,789 E402A possibly damaging Het
Egf T C 3: 129,718,064 probably null Het
Epha5 T C 5: 84,416,462 Q15R possibly damaging Het
Esyt3 A G 9: 99,315,285 F831L probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fut7 A G 2: 25,425,780 D350G probably benign Het
Gab1 C A 8: 80,784,817 E466D probably damaging Het
Glrp1 A T 1: 88,503,168 M160K unknown Het
Gngt1 T C 6: 3,994,088 probably null Het
Gprc6a A T 10: 51,631,412 V7E possibly damaging Het
Idh3b A T 2: 130,280,966 V301D probably damaging Het
Ifi202b A C 1: 173,963,958 C385G probably benign Het
Ilvbl T A 10: 78,579,086 L261Q probably damaging Het
Irx6 T A 8: 92,678,734 L410Q probably damaging Het
Ism2 T C 12: 87,299,663 M15V unknown Het
Klra3 C T 6: 130,327,124 G202R probably damaging Het
Krt7 T C 15: 101,413,970 V103A probably damaging Het
Lama3 T C 18: 12,528,418 S2145P probably damaging Het
Mlph A G 1: 90,941,706 R477G probably damaging Het
Mybpc1 T A 10: 88,543,719 L653F probably damaging Het
Myrfl A G 10: 116,781,947 probably null Het
Myrip T G 9: 120,422,507 L232R probably damaging Het
Nrd1 A T 4: 109,028,802 H126L probably benign Het
Olfr251 T A 9: 38,378,802 L307Q possibly damaging Het
Olfr469 G T 7: 107,823,158 L104I probably benign Het
Olfr722 A T 14: 49,895,667 I45N probably damaging Het
Pcdhb10 T A 18: 37,413,003 N377K probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Prkdc A C 16: 15,769,966 I2572L probably benign Het
Ptpro C A 6: 137,380,478 D322E probably benign Het
R3hcc1 A G 14: 69,704,125 I332T probably damaging Het
Rab8a T C 8: 72,161,383 F9L probably damaging Het
Ranbp3l A T 15: 9,057,160 K165N probably damaging Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rsad2 T A 12: 26,456,419 M1L possibly damaging Het
Tymp A T 15: 89,376,281 probably null Het
Vmn1r104 A G 7: 20,534,566 M244V probably benign Het
Vmn1r232 G A 17: 20,913,285 T351M possibly damaging Het
Vmn2r50 A G 7: 10,050,245 Y101H probably benign Het
Vmn2r57 A G 7: 41,428,665 L123P probably damaging Het
Wdr17 T C 8: 54,681,453 N331D probably damaging Het
Wdr47 C T 3: 108,614,355 Q89* probably null Het
Zcchc4 A T 5: 52,784,033 T57S probably benign Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10190289 missense probably damaging 1.00
IGL02125:Itih5 APN 2 10240987 missense probably benign
IGL02370:Itih5 APN 2 10186975 missense probably benign 0.05
IGL03376:Itih5 APN 2 10206773 missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10251351 missense probably benign 0.01
R0090:Itih5 UTSW 2 10164684 missense probably benign 0.03
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0158:Itih5 UTSW 2 10234992 splice site probably benign
R0270:Itih5 UTSW 2 10251264 missense probably benign 0.38
R0276:Itih5 UTSW 2 10185564 missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0810:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0903:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0905:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0906:Itih5 UTSW 2 10249188 missense probably benign 0.00
R1104:Itih5 UTSW 2 10251512 missense probably benign 0.03
R1397:Itih5 UTSW 2 10240807 missense probably benign 0.14
R1671:Itih5 UTSW 2 10186971 missense probably benign 0.03
R1971:Itih5 UTSW 2 10238568 missense probably damaging 1.00
R3684:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10251270 missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10245544 missense probably damaging 0.98
R4670:Itih5 UTSW 2 10190369 missense probably benign 0.01
R4803:Itih5 UTSW 2 10240581 missense probably benign
R4950:Itih5 UTSW 2 10235081 missense probably damaging 0.98
R5020:Itih5 UTSW 2 10240504 splice site probably null
R5735:Itih5 UTSW 2 10240761 missense probably benign 0.00
R6454:Itih5 UTSW 2 10240668 missense probably benign
R6662:Itih5 UTSW 2 10249181 missense probably benign 0.13
R7068:Itih5 UTSW 2 10249304 missense probably damaging 0.99
R7246:Itih5 UTSW 2 10187062 splice site probably null
R7424:Itih5 UTSW 2 10245637 missense probably damaging 1.00
R7452:Itih5 UTSW 2 10238796 missense probably damaging 1.00
R7597:Itih5 UTSW 2 10249376 missense probably damaging 1.00
R8025:Itih5 UTSW 2 10241022 missense probably benign 0.13
R8253:Itih5 UTSW 2 10238595 missense probably benign 0.06
R8349:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8439:Itih5 UTSW 2 10235058 missense probably benign 0.19
R8449:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8825:Itih5 UTSW 2 10190420 missense probably benign 0.00
R9110:Itih5 UTSW 2 10187020 missense probably benign
R9582:Itih5 UTSW 2 10190202 missense probably benign 0.07
R9744:Itih5 UTSW 2 10251410 missense probably damaging 1.00
X0026:Itih5 UTSW 2 10238559 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTCTCCTTGGCAAGTATAGCAGG -3'
(R):5'- ACTCCCAACTTTGAGCATCC -3'

Sequencing Primer
(F):5'- CTTGGCAAGTATAGCAGGTGACC -3'
(R):5'- CTTTGAGCATCCCATAAGATCTGAGC -3'
Posted On 2019-05-13