Incidental Mutation 'R7019:Itih5'
ID 545487
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha-trypsin inhibitor, heavy chain 5
Synonyms 4631408O11Rik, 5430408M01Rik
MMRRC Submission 045120-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R7019 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 10158382-10261340 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 10195138 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 177 (R177S)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect probably damaging
Transcript: ENSMUST00000026886
AA Change: R177S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: R177S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A T 16: 8,436,395 (GRCm39) K414* probably null Het
Aco1 T A 4: 40,186,376 (GRCm39) I596N probably damaging Het
Adgre1 A C 17: 57,717,945 (GRCm39) D319A probably damaging Het
Birc6 T C 17: 74,916,340 (GRCm39) V445A probably benign Het
Btd A C 14: 31,389,062 (GRCm39) Q261P probably damaging Het
Btd G T 14: 31,389,063 (GRCm39) Q261H possibly damaging Het
C7 T A 15: 5,075,164 (GRCm39) Y176F probably benign Het
Ccdc102a T C 8: 95,636,431 (GRCm39) S287G probably benign Het
Ccdc178 T A 18: 22,283,495 (GRCm39) T12S probably benign Het
Cnga4 G T 7: 105,055,036 (GRCm39) A104S probably benign Het
Col10a1 G T 10: 34,270,947 (GRCm39) L306F probably damaging Het
Cpne5 T C 17: 29,445,196 (GRCm39) D36G probably damaging Het
Csmd2 G A 4: 128,262,856 (GRCm39) D681N Het
Cspg4b C T 13: 113,488,284 (GRCm39) T102I probably benign Het
Cstl1 A G 2: 148,597,223 (GRCm39) M75V probably benign Het
Cyp26a1 T C 19: 37,687,260 (GRCm39) L149P probably damaging Het
D630045J12Rik T G 6: 38,171,570 (GRCm39) E866A probably benign Het
Dlec1 C T 9: 118,941,490 (GRCm39) P292L probably benign Het
Dpp3 T G 19: 4,966,817 (GRCm39) E402A possibly damaging Het
Egf T C 3: 129,511,713 (GRCm39) probably null Het
Epha5 T C 5: 84,564,321 (GRCm39) Q15R possibly damaging Het
Esyt3 A G 9: 99,197,338 (GRCm39) F831L probably benign Het
Fam50b G A 13: 34,931,084 (GRCm39) E187K possibly damaging Het
Fut7 A G 2: 25,315,792 (GRCm39) D350G probably benign Het
Gab1 C A 8: 81,511,446 (GRCm39) E466D probably damaging Het
Glrp1 A T 1: 88,430,890 (GRCm39) M160K unknown Het
Gngt1 T C 6: 3,994,088 (GRCm39) probably null Het
Gprc6a A T 10: 51,507,508 (GRCm39) V7E possibly damaging Het
Idh3b A T 2: 130,122,886 (GRCm39) V301D probably damaging Het
Ifi202b A C 1: 173,791,524 (GRCm39) C385G probably benign Het
Ilvbl T A 10: 78,414,920 (GRCm39) L261Q probably damaging Het
Irx6 T A 8: 93,405,362 (GRCm39) L410Q probably damaging Het
Ism2 T C 12: 87,346,437 (GRCm39) M15V unknown Het
Klra3 C T 6: 130,304,087 (GRCm39) G202R probably damaging Het
Krt7 T C 15: 101,311,851 (GRCm39) V103A probably damaging Het
Lama3 T C 18: 12,661,475 (GRCm39) S2145P probably damaging Het
Mlph A G 1: 90,869,428 (GRCm39) R477G probably damaging Het
Mybpc1 T A 10: 88,379,581 (GRCm39) L653F probably damaging Het
Myrfl A G 10: 116,617,852 (GRCm39) probably null Het
Myrip T G 9: 120,251,573 (GRCm39) L232R probably damaging Het
Nrdc A T 4: 108,885,999 (GRCm39) H126L probably benign Het
Or4n5 A T 14: 50,133,124 (GRCm39) I45N probably damaging Het
Or5p50 G T 7: 107,422,365 (GRCm39) L104I probably benign Het
Or8c11 T A 9: 38,290,098 (GRCm39) L307Q possibly damaging Het
Pcdhb10 T A 18: 37,546,056 (GRCm39) N377K probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Prkdc A C 16: 15,587,830 (GRCm39) I2572L probably benign Het
Ptpro C A 6: 137,357,476 (GRCm39) D322E probably benign Het
R3hcc1 A G 14: 69,941,574 (GRCm39) I332T probably damaging Het
Rab8a T C 8: 72,915,227 (GRCm39) F9L probably damaging Het
Ranbp3l A T 15: 9,057,241 (GRCm39) K165N probably damaging Het
Rock2 T A 12: 17,027,741 (GRCm39) C1353S probably damaging Het
Rsad2 T A 12: 26,506,418 (GRCm39) M1L possibly damaging Het
Tymp A T 15: 89,260,484 (GRCm39) probably null Het
Vmn1r104 A G 7: 20,268,491 (GRCm39) M244V probably benign Het
Vmn1r232 G A 17: 21,133,547 (GRCm39) T351M possibly damaging Het
Vmn2r50 A G 7: 9,784,172 (GRCm39) Y101H probably benign Het
Vmn2r57 A G 7: 41,078,089 (GRCm39) L123P probably damaging Het
Wdr17 T C 8: 55,134,488 (GRCm39) N331D probably damaging Het
Wdr47 C T 3: 108,521,671 (GRCm39) Q89* probably null Het
Zcchc4 A T 5: 52,941,375 (GRCm39) T57S probably benign Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10,195,100 (GRCm39) missense probably damaging 1.00
IGL02125:Itih5 APN 2 10,245,798 (GRCm39) missense probably benign
IGL02370:Itih5 APN 2 10,191,786 (GRCm39) missense probably benign 0.05
IGL03376:Itih5 APN 2 10,211,584 (GRCm39) missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10,256,162 (GRCm39) missense probably benign 0.01
R0090:Itih5 UTSW 2 10,169,495 (GRCm39) missense probably benign 0.03
R0096:Itih5 UTSW 2 10,256,189 (GRCm39) missense probably benign 0.02
R0096:Itih5 UTSW 2 10,256,189 (GRCm39) missense probably benign 0.02
R0158:Itih5 UTSW 2 10,239,803 (GRCm39) splice site probably benign
R0270:Itih5 UTSW 2 10,256,075 (GRCm39) missense probably benign 0.38
R0276:Itih5 UTSW 2 10,190,375 (GRCm39) missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0810:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0903:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0905:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0906:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R1104:Itih5 UTSW 2 10,256,323 (GRCm39) missense probably benign 0.03
R1397:Itih5 UTSW 2 10,245,618 (GRCm39) missense probably benign 0.14
R1671:Itih5 UTSW 2 10,191,782 (GRCm39) missense probably benign 0.03
R1971:Itih5 UTSW 2 10,243,379 (GRCm39) missense probably damaging 1.00
R3684:Itih5 UTSW 2 10,243,435 (GRCm39) missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10,243,435 (GRCm39) missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10,256,081 (GRCm39) missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10,250,355 (GRCm39) missense probably damaging 0.98
R4670:Itih5 UTSW 2 10,195,180 (GRCm39) missense probably benign 0.01
R4803:Itih5 UTSW 2 10,245,392 (GRCm39) missense probably benign
R4950:Itih5 UTSW 2 10,239,892 (GRCm39) missense probably damaging 0.98
R5020:Itih5 UTSW 2 10,245,315 (GRCm39) splice site probably null
R5735:Itih5 UTSW 2 10,245,572 (GRCm39) missense probably benign 0.00
R6454:Itih5 UTSW 2 10,245,479 (GRCm39) missense probably benign
R6662:Itih5 UTSW 2 10,253,992 (GRCm39) missense probably benign 0.13
R7068:Itih5 UTSW 2 10,254,115 (GRCm39) missense probably damaging 0.99
R7246:Itih5 UTSW 2 10,191,873 (GRCm39) splice site probably null
R7424:Itih5 UTSW 2 10,250,448 (GRCm39) missense probably damaging 1.00
R7452:Itih5 UTSW 2 10,243,607 (GRCm39) missense probably damaging 1.00
R7597:Itih5 UTSW 2 10,254,187 (GRCm39) missense probably damaging 1.00
R8025:Itih5 UTSW 2 10,245,833 (GRCm39) missense probably benign 0.13
R8253:Itih5 UTSW 2 10,243,406 (GRCm39) missense probably benign 0.06
R8349:Itih5 UTSW 2 10,191,800 (GRCm39) missense probably benign 0.01
R8439:Itih5 UTSW 2 10,239,869 (GRCm39) missense probably benign 0.19
R8449:Itih5 UTSW 2 10,191,800 (GRCm39) missense probably benign 0.01
R8825:Itih5 UTSW 2 10,195,231 (GRCm39) missense probably benign 0.00
R9110:Itih5 UTSW 2 10,191,831 (GRCm39) missense probably benign
R9582:Itih5 UTSW 2 10,195,013 (GRCm39) missense probably benign 0.07
R9744:Itih5 UTSW 2 10,256,221 (GRCm39) missense probably damaging 1.00
X0026:Itih5 UTSW 2 10,243,370 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- GTCTCCTTGGCAAGTATAGCAGG -3'
(R):5'- ACTCCCAACTTTGAGCATCC -3'

Sequencing Primer
(F):5'- CTTGGCAAGTATAGCAGGTGACC -3'
(R):5'- CTTTGAGCATCCCATAAGATCTGAGC -3'
Posted On 2019-05-13