Incidental Mutation 'R0609:Tnfaip2'
ID 54549
Institutional Source Beutler Lab
Gene Symbol Tnfaip2
Ensembl Gene ENSMUSG00000021281
Gene Name tumor necrosis factor, alpha-induced protein 2
Synonyms M-sec, Tnfip2, Exoc3l3
MMRRC Submission 038798-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0609 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 111408903-111421452 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111419941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 691 (N691S)
Ref Sequence ENSEMBL: ENSMUSP00000105415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102745] [ENSMUST00000109792] [ENSMUST00000174298] [ENSMUST00000172783]
AlphaFold Q61333
Predicted Effect probably benign
Transcript: ENSMUST00000102745
AA Change: N674S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099806
Gene: ENSMUSG00000021281
AA Change: N674S

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
Pfam:Sec6 157 688 1.3e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109792
AA Change: N691S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000105415
Gene: ENSMUSG00000021281
AA Change: N691S

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
Pfam:Sec6 157 705 1.7e-107 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156003
Predicted Effect probably benign
Transcript: ENSMUST00000174298
SMART Domains Protein: ENSMUSP00000133317
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
low complexity region 42 54 N/A INTRINSIC
low complexity region 65 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172783
SMART Domains Protein: ENSMUSP00000133635
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221429
Predicted Effect probably benign
Transcript: ENSMUST00000173581
Predicted Effect probably benign
Transcript: ENSMUST00000174692
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a gene whose expression can be induced by the tumor necrosis factor alpha (TNF) in umbilical vein endothelial cells. The expression of this gene was shown to be induced by retinoic acid in a cell line expressing a oncogenic version of the retinoic acid receptor alpha fusion protein, which suggested that this gene may be a retinoic acid target gene in acute promyelocytic leukemia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A T 14: 35,533,418 (GRCm39) probably null Het
Abcb4 T A 5: 8,997,376 (GRCm39) C952S probably damaging Het
Adamtsl2 A G 2: 26,979,647 (GRCm39) D272G probably benign Het
Aim2 G A 1: 173,289,530 (GRCm39) D158N probably damaging Het
Aldh3b1 C T 19: 3,964,024 (GRCm39) R426H probably damaging Het
Apoc2 A G 7: 19,407,278 (GRCm39) S28P probably benign Het
Arfgef3 G A 10: 18,473,179 (GRCm39) T1628I probably benign Het
Atp10a G A 7: 58,469,488 (GRCm39) probably null Het
Bcl2 G A 1: 106,640,292 (GRCm39) R107C probably damaging Het
Bmp8b T A 4: 123,015,692 (GRCm39) D226E probably benign Het
Brsk2 T C 7: 141,552,229 (GRCm39) Y618H probably damaging Het
Casp12 T A 9: 5,346,554 (GRCm39) F27Y probably damaging Het
Casp8 T A 1: 58,883,951 (GRCm39) N439K probably benign Het
Ccdc175 T A 12: 72,204,281 (GRCm39) K253N probably benign Het
Cdc42bpa A G 1: 179,867,744 (GRCm39) H193R probably damaging Het
Cdk17 T C 10: 93,052,334 (GRCm39) M105T probably benign Het
Cdon C A 9: 35,389,907 (GRCm39) P854T probably damaging Het
Cep44 A G 8: 56,997,187 (GRCm39) M117T possibly damaging Het
Cep89 A T 7: 35,134,955 (GRCm39) E674D probably damaging Het
Cit C T 5: 116,012,002 (GRCm39) A203V probably damaging Het
Clstn1 C A 4: 149,713,757 (GRCm39) probably null Het
Col7a1 T A 9: 108,787,215 (GRCm39) D565E unknown Het
Cpb1 T A 3: 20,316,638 (GRCm39) Y304F probably damaging Het
Cps1 T G 1: 67,211,961 (GRCm39) Y710D probably damaging Het
Creb3l1 T C 2: 91,817,398 (GRCm39) T372A possibly damaging Het
Dars1 A G 1: 128,333,118 (GRCm39) V102A probably benign Het
Dhx35 C T 2: 158,659,335 (GRCm39) T168I possibly damaging Het
Dnah5 T C 15: 28,327,925 (GRCm39) S2100P probably benign Het
Dst T C 1: 34,306,041 (GRCm39) probably null Het
Egflam A C 15: 7,283,004 (GRCm39) L351R possibly damaging Het
Elp2 T A 18: 24,759,213 (GRCm39) D523E probably benign Het
Exo5 C A 4: 120,778,881 (GRCm39) G328V probably damaging Het
Fut9 A G 4: 25,620,811 (GRCm39) M1T probably null Het
Galnt5 A G 2: 57,914,637 (GRCm39) N584S possibly damaging Het
Gbp3 T C 3: 142,273,533 (GRCm39) V360A probably damaging Het
Gdf6 G A 4: 9,859,977 (GRCm39) C353Y probably damaging Het
Hace1 A G 10: 45,524,965 (GRCm39) T244A probably damaging Het
Hr T C 14: 70,797,097 (GRCm39) I500T probably benign Het
Ifnl2 A T 7: 28,208,707 (GRCm39) L115Q probably damaging Het
Iigp1 T C 18: 60,522,896 (GRCm39) F5L probably benign Het
Inhbb A G 1: 119,345,146 (GRCm39) L381P probably damaging Het
Irx3 A T 8: 92,527,721 (GRCm39) S50T probably benign Het
Ivns1abp C T 1: 151,235,896 (GRCm39) T363I probably benign Het
Izumo1 A T 7: 45,272,323 (GRCm39) T35S probably benign Het
Kank4 A G 4: 98,665,342 (GRCm39) S651P probably damaging Het
Kit T C 5: 75,771,539 (GRCm39) V232A probably benign Het
Klhl11 T C 11: 100,354,540 (GRCm39) Y427C probably damaging Het
Laptm4b T A 15: 34,258,835 (GRCm39) N36K probably damaging Het
Lrrk1 T C 7: 65,916,363 (GRCm39) probably null Het
Mamdc4 G T 2: 25,454,205 (GRCm39) Q1042K probably benign Het
Mical2 A G 7: 111,920,647 (GRCm39) probably null Het
Ms4a3 C A 19: 11,608,725 (GRCm39) V176F possibly damaging Het
Myo3a T C 2: 22,338,324 (GRCm39) V427A probably benign Het
Myo3a A C 2: 22,401,110 (GRCm39) E626D possibly damaging Het
Nckap5 A T 1: 125,955,025 (GRCm39) L509* probably null Het
Ndufa5 A T 6: 24,519,248 (GRCm39) D64E possibly damaging Het
Nedd4l T C 18: 65,341,532 (GRCm39) Y753H probably damaging Het
Nynrin T C 14: 56,110,218 (GRCm39) V1775A probably damaging Het
Oplah A G 15: 76,187,192 (GRCm39) S570P probably benign Het
Or14c39 T C 7: 86,344,084 (GRCm39) V140A possibly damaging Het
Or2ag1b A T 7: 106,288,205 (GRCm39) H244Q probably damaging Het
Or4q3 T C 14: 50,583,383 (GRCm39) Y141C probably damaging Het
Or5t18 A G 2: 86,637,205 (GRCm39) L46S probably damaging Het
Or9r3 G A 10: 129,948,449 (GRCm39) S70F probably damaging Het
Osbpl11 C A 16: 33,054,814 (GRCm39) Y632* probably null Het
Osbpl5 A T 7: 143,248,558 (GRCm39) L644Q probably damaging Het
Pcdhb19 T C 18: 37,631,005 (GRCm39) W267R probably benign Het
Pkhd1l1 A C 15: 44,330,820 (GRCm39) S132R possibly damaging Het
Pramel23 A T 4: 143,425,073 (GRCm39) D123E probably benign Het
Ptpn13 T A 5: 103,704,011 (GRCm39) S1348T probably benign Het
Rc3h1 T A 1: 160,757,705 (GRCm39) W8R probably damaging Het
Rgs3 T G 4: 62,544,173 (GRCm39) V315G probably damaging Het
Rora T A 9: 69,269,151 (GRCm39) M82K probably damaging Het
Rph3al T C 11: 75,799,795 (GRCm39) I55V probably benign Het
Sag T C 1: 87,740,713 (GRCm39) V45A probably damaging Het
Scn3a T C 2: 65,366,854 (GRCm39) E56G probably damaging Het
Sec24c T G 14: 20,737,016 (GRCm39) V324G probably damaging Het
Sptbn1 A G 11: 30,088,979 (GRCm39) L748S probably damaging Het
Stard9 A T 2: 120,536,787 (GRCm39) D4186V probably damaging Het
Stk39 T C 2: 68,196,511 (GRCm39) E306G probably damaging Het
Sycp1 C A 3: 102,806,165 (GRCm39) probably null Het
Taf2 A C 15: 54,923,446 (GRCm39) L277R probably damaging Het
Tasor C T 14: 27,183,707 (GRCm39) T722I probably benign Het
Tbc1d23 T A 16: 56,993,469 (GRCm39) I566F possibly damaging Het
Tekt5 T C 16: 10,179,168 (GRCm39) T400A possibly damaging Het
Tgfbrap1 T C 1: 43,099,301 (GRCm39) H401R probably benign Het
Tie1 T A 4: 118,333,344 (GRCm39) I841L possibly damaging Het
Tln1 T G 4: 43,544,645 (GRCm39) T1095P possibly damaging Het
Tmem147 A G 7: 30,427,527 (GRCm39) Y72H probably benign Het
Trim24 G A 6: 37,934,718 (GRCm39) C811Y probably damaging Het
Trim30b T A 7: 104,007,183 (GRCm39) probably benign Het
Trpc4 T G 3: 54,102,189 (GRCm39) L29R probably damaging Het
Trpm6 A T 19: 18,803,226 (GRCm39) I890F probably damaging Het
Ttc23l C T 15: 10,504,622 (GRCm39) E442K probably benign Het
Tut7 A T 13: 59,947,596 (GRCm39) C506* probably null Het
Uggt2 A G 14: 119,332,748 (GRCm39) V62A probably damaging Het
Ugt1a6a C A 1: 88,066,606 (GRCm39) S137R probably benign Het
Unc13a A G 8: 72,111,111 (GRCm39) Y367H probably damaging Het
Vmn2r49 A G 7: 9,710,233 (GRCm39) I833T probably benign Het
Vmn2r7 T C 3: 64,623,900 (GRCm39) D231G probably benign Het
Ythdc2 A T 18: 44,997,424 (GRCm39) M994L probably benign Het
Zfp804a G A 2: 82,087,932 (GRCm39) S587N probably damaging Het
Zswim2 A G 2: 83,754,003 (GRCm39) I219T probably benign Het
Other mutations in Tnfaip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Tnfaip2 APN 12 111,419,983 (GRCm39) missense probably damaging 1.00
IGL01352:Tnfaip2 APN 12 111,412,053 (GRCm39) missense probably damaging 1.00
IGL02550:Tnfaip2 APN 12 111,412,535 (GRCm39) missense probably damaging 1.00
R0103:Tnfaip2 UTSW 12 111,412,244 (GRCm39) missense probably benign 0.38
R0145:Tnfaip2 UTSW 12 111,412,292 (GRCm39) missense possibly damaging 0.87
R0324:Tnfaip2 UTSW 12 111,419,893 (GRCm39) missense probably damaging 1.00
R0837:Tnfaip2 UTSW 12 111,417,141 (GRCm39) missense probably damaging 1.00
R1353:Tnfaip2 UTSW 12 111,411,403 (GRCm39) missense probably damaging 1.00
R1366:Tnfaip2 UTSW 12 111,415,756 (GRCm39) missense probably benign 0.00
R1988:Tnfaip2 UTSW 12 111,416,325 (GRCm39) critical splice donor site probably null
R2109:Tnfaip2 UTSW 12 111,414,527 (GRCm39) missense probably damaging 1.00
R2147:Tnfaip2 UTSW 12 111,412,456 (GRCm39) missense probably damaging 1.00
R4003:Tnfaip2 UTSW 12 111,417,778 (GRCm39) splice site probably benign
R4402:Tnfaip2 UTSW 12 111,416,285 (GRCm39) missense probably benign 0.43
R4690:Tnfaip2 UTSW 12 111,411,682 (GRCm39) missense possibly damaging 0.66
R4718:Tnfaip2 UTSW 12 111,412,463 (GRCm39) missense possibly damaging 0.95
R5271:Tnfaip2 UTSW 12 111,414,894 (GRCm39) intron probably benign
R6478:Tnfaip2 UTSW 12 111,412,097 (GRCm39) missense probably damaging 1.00
R7623:Tnfaip2 UTSW 12 111,412,072 (GRCm39) missense probably damaging 0.98
R8951:Tnfaip2 UTSW 12 111,412,310 (GRCm39) missense probably benign 0.01
R9168:Tnfaip2 UTSW 12 111,411,382 (GRCm39) missense probably damaging 1.00
R9407:Tnfaip2 UTSW 12 111,412,161 (GRCm39) missense probably benign
R9607:Tnfaip2 UTSW 12 111,412,069 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCAGAGAGTGCAAAGCCACTTAGAG -3'
(R):5'- GCTGTCAGATCTTGTTCCAGAGCC -3'

Sequencing Primer
(F):5'- GCCACTTAGAGACATGACATTTAGC -3'
(R):5'- TTCCAGAGCCAGGGCTG -3'
Posted On 2013-07-11