Incidental Mutation 'R7019:Wdr47'
ID545492
Institutional Source Beutler Lab
Gene Symbol Wdr47
Ensembl Gene ENSMUSG00000040389
Gene NameWD repeat domain 47
Synonyms1810073M12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7019 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location108591279-108645719 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 108614355 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 89 (Q89*)
Ref Sequence ENSEMBL: ENSMUSP00000057482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051145] [ENSMUST00000124731]
Predicted Effect probably null
Transcript: ENSMUST00000051145
AA Change: Q89*
SMART Domains Protein: ENSMUSP00000057482
Gene: ENSMUSG00000040389
AA Change: Q89*

DomainStartEndE-ValueType
LisH 10 42 8.87e-4 SMART
CTLH 45 102 1.93e-13 SMART
low complexity region 137 146 N/A INTRINSIC
low complexity region 226 254 N/A INTRINSIC
coiled coil region 414 455 N/A INTRINSIC
low complexity region 506 523 N/A INTRINSIC
WD40 597 635 7e-4 SMART
WD40 648 690 5.18e-7 SMART
WD40 698 742 2.28e2 SMART
WD40 745 783 9.38e-5 SMART
WD40 790 829 1.31e-3 SMART
WD40 832 871 1.28e-6 SMART
WD40 878 917 7.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124731
SMART Domains Protein: ENSMUSP00000143335
Gene: ENSMUSG00000040389

DomainStartEndE-ValueType
LisH 10 42 2.7e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A T 16: 8,618,531 K414* probably null Het
Aco1 T A 4: 40,186,376 I596N probably damaging Het
Adgre1 A C 17: 57,410,945 D319A probably damaging Het
BC067074 C T 13: 113,351,750 T102I probably benign Het
Birc6 T C 17: 74,609,345 V445A probably benign Het
Btd A C 14: 31,667,105 Q261P probably damaging Het
Btd G T 14: 31,667,106 Q261H possibly damaging Het
C7 T A 15: 5,045,682 Y176F probably benign Het
Ccdc102a T C 8: 94,909,803 S287G probably benign Het
Ccdc178 T A 18: 22,150,438 T12S probably benign Het
Cnga4 G T 7: 105,405,829 A104S probably benign Het
Col10a1 G T 10: 34,394,951 L306F probably damaging Het
Cpne5 T C 17: 29,226,222 D36G probably damaging Het
Csmd2 G A 4: 128,369,063 D681N Het
Cstl1 A G 2: 148,755,303 M75V probably benign Het
Cyp26a1 T C 19: 37,698,812 L149P probably damaging Het
D630045J12Rik T G 6: 38,194,635 E866A probably benign Het
Dlec1 C T 9: 119,112,422 P292L probably benign Het
Dpp3 T G 19: 4,916,789 E402A possibly damaging Het
Egf T C 3: 129,718,064 probably null Het
Epha5 T C 5: 84,416,462 Q15R possibly damaging Het
Esyt3 A G 9: 99,315,285 F831L probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fut7 A G 2: 25,425,780 D350G probably benign Het
Gab1 C A 8: 80,784,817 E466D probably damaging Het
Glrp1 A T 1: 88,503,168 M160K unknown Het
Gngt1 T C 6: 3,994,088 probably null Het
Gprc6a A T 10: 51,631,412 V7E possibly damaging Het
Idh3b A T 2: 130,280,966 V301D probably damaging Het
Ifi202b A C 1: 173,963,958 C385G probably benign Het
Ilvbl T A 10: 78,579,086 L261Q probably damaging Het
Irx6 T A 8: 92,678,734 L410Q probably damaging Het
Ism2 T C 12: 87,299,663 M15V unknown Het
Itih5 C A 2: 10,190,327 R177S probably damaging Het
Klra3 C T 6: 130,327,124 G202R probably damaging Het
Krt7 T C 15: 101,413,970 V103A probably damaging Het
Lama3 T C 18: 12,528,418 S2145P probably damaging Het
Mlph A G 1: 90,941,706 R477G probably damaging Het
Mybpc1 T A 10: 88,543,719 L653F probably damaging Het
Myrfl A G 10: 116,781,947 probably null Het
Myrip T G 9: 120,422,507 L232R probably damaging Het
Nrd1 A T 4: 109,028,802 H126L probably benign Het
Olfr251 T A 9: 38,378,802 L307Q possibly damaging Het
Olfr469 G T 7: 107,823,158 L104I probably benign Het
Olfr722 A T 14: 49,895,667 I45N probably damaging Het
Pcdhb10 T A 18: 37,413,003 N377K probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Prkdc A C 16: 15,769,966 I2572L probably benign Het
Ptpro C A 6: 137,380,478 D322E probably benign Het
R3hcc1 A G 14: 69,704,125 I332T probably damaging Het
Rab8a T C 8: 72,161,383 F9L probably damaging Het
Ranbp3l A T 15: 9,057,160 K165N probably damaging Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rsad2 T A 12: 26,456,419 M1L possibly damaging Het
Tymp A T 15: 89,376,281 probably null Het
Vmn1r104 A G 7: 20,534,566 M244V probably benign Het
Vmn1r232 G A 17: 20,913,285 T351M possibly damaging Het
Vmn2r50 A G 7: 10,050,245 Y101H probably benign Het
Vmn2r57 A G 7: 41,428,665 L123P probably damaging Het
Wdr17 T C 8: 54,681,453 N331D probably damaging Het
Zcchc4 A T 5: 52,784,033 T57S probably benign Het
Other mutations in Wdr47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Wdr47 APN 3 108618734 missense probably benign 0.04
IGL01730:Wdr47 APN 3 108611396 missense probably damaging 1.00
IGL01821:Wdr47 APN 3 108627204 missense probably damaging 1.00
IGL03367:Wdr47 APN 3 108629773 splice site probably benign
R0025:Wdr47 UTSW 3 108637991 missense probably damaging 1.00
R0217:Wdr47 UTSW 3 108637020 missense probably damaging 0.96
R0733:Wdr47 UTSW 3 108618623 missense probably damaging 1.00
R1329:Wdr47 UTSW 3 108627299 missense probably benign 0.14
R1330:Wdr47 UTSW 3 108629753 missense probably benign 0.30
R1894:Wdr47 UTSW 3 108623376 missense possibly damaging 0.56
R2004:Wdr47 UTSW 3 108627442 nonsense probably null
R2040:Wdr47 UTSW 3 108623372 missense probably benign 0.01
R2242:Wdr47 UTSW 3 108619115 missense probably damaging 1.00
R3795:Wdr47 UTSW 3 108624737 critical splice donor site probably null
R5026:Wdr47 UTSW 3 108618522 nonsense probably null
R5732:Wdr47 UTSW 3 108633156 nonsense probably null
R5823:Wdr47 UTSW 3 108643085 missense probably damaging 1.00
R5838:Wdr47 UTSW 3 108624736 critical splice donor site probably null
R5890:Wdr47 UTSW 3 108610012 missense probably damaging 1.00
R5896:Wdr47 UTSW 3 108619006 missense probably damaging 1.00
R5898:Wdr47 UTSW 3 108637885 splice site probably null
R6778:Wdr47 UTSW 3 108633096 missense probably benign 0.16
R7051:Wdr47 UTSW 3 108618524 missense probably damaging 1.00
R7535:Wdr47 UTSW 3 108629711 missense probably benign 0.01
R7642:Wdr47 UTSW 3 108643164 missense possibly damaging 0.47
R7709:Wdr47 UTSW 3 108618521 missense probably damaging 1.00
R8048:Wdr47 UTSW 3 108618968 missense probably damaging 0.99
X0062:Wdr47 UTSW 3 108619058 missense probably benign 0.01
Z1177:Wdr47 UTSW 3 108619114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGACTTGTGCTCCTGAAG -3'
(R):5'- CAGATCTTGCCTCATCATAGCTCAC -3'

Sequencing Primer
(F):5'- GCTCCTGAAGCCTCTCTAGG -3'
(R):5'- GTCTGAAGACAGCTACAGTGTACTC -3'
Posted On2019-05-13