Incidental Mutation 'R0609:Sec24c'
ID 54551
Institutional Source Beutler Lab
Gene Symbol Sec24c
Ensembl Gene ENSMUSG00000039367
Gene Name Sec24 related gene family, member C (S. cerevisiae)
Synonyms 2610204K03Rik
MMRRC Submission 038798-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0609 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 20674308-20694852 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 20686948 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 324 (V324G)
Ref Sequence ENSEMBL: ENSMUSP00000153434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048657] [ENSMUST00000223751] [ENSMUST00000224492] [ENSMUST00000224791] [ENSMUST00000224876] [ENSMUST00000225108]
AlphaFold G3X972
Predicted Effect probably damaging
Transcript: ENSMUST00000048657
AA Change: V400G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045955
Gene: ENSMUSG00000039367
AA Change: V400G

DomainStartEndE-ValueType
low complexity region 28 47 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 183 194 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 256 279 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 424 462 8.2e-17 PFAM
Pfam:Sec23_trunk 501 745 7.3e-94 PFAM
Pfam:Sec23_BS 750 834 8e-20 PFAM
Pfam:Sec23_helical 847 948 2.3e-30 PFAM
Pfam:Gelsolin 963 1038 1.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183515
Predicted Effect probably damaging
Transcript: ENSMUST00000223751
AA Change: V324G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224722
Predicted Effect probably benign
Transcript: ENSMUST00000224791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224793
Predicted Effect probably benign
Transcript: ENSMUST00000224876
Predicted Effect probably benign
Transcript: ENSMUST00000225108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225903
Predicted Effect probably benign
Transcript: ENSMUST00000228545
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The product of this gene may play a role in shaping the vesicle, as well as in cargo selection and concentration. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display complete embryonic lethality between implantation and placentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A T 14: 35,811,461 probably null Het
Abcb4 T A 5: 8,947,376 C952S probably damaging Het
Adamtsl2 A G 2: 27,089,635 D272G probably benign Het
Aim2 G A 1: 173,461,964 D158N probably damaging Het
Aldh3b1 C T 19: 3,914,024 R426H probably damaging Het
Apoc2 A G 7: 19,673,353 S28P probably benign Het
Arfgef3 G A 10: 18,597,431 T1628I probably benign Het
Atp10a G A 7: 58,819,740 probably null Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Bmp8b T A 4: 123,121,899 D226E probably benign Het
Brsk2 T C 7: 141,998,492 Y618H probably damaging Het
Casp12 T A 9: 5,346,554 F27Y probably damaging Het
Casp8 T A 1: 58,844,792 N439K probably benign Het
Ccdc175 T A 12: 72,157,507 K253N probably benign Het
Cdc42bpa A G 1: 180,040,179 H193R probably damaging Het
Cdk17 T C 10: 93,216,472 M105T probably benign Het
Cdon C A 9: 35,478,611 P854T probably damaging Het
Cep44 A G 8: 56,544,152 M117T possibly damaging Het
Cep89 A T 7: 35,435,530 E674D probably damaging Het
Cit C T 5: 115,873,943 A203V probably damaging Het
Clstn1 C A 4: 149,629,300 probably null Het
Col7a1 T A 9: 108,958,147 D565E unknown Het
Cpb1 T A 3: 20,262,474 Y304F probably damaging Het
Cps1 T G 1: 67,172,802 Y710D probably damaging Het
Creb3l1 T C 2: 91,987,053 T372A possibly damaging Het
Dars A G 1: 128,405,381 V102A probably benign Het
Dhx35 C T 2: 158,817,415 T168I possibly damaging Het
Dnah5 T C 15: 28,327,779 S2100P probably benign Het
Dst T C 1: 34,266,960 probably null Het
Egflam A C 15: 7,253,523 L351R possibly damaging Het
Elp2 T A 18: 24,626,156 D523E probably benign Het
Exo5 C A 4: 120,921,684 G328V probably damaging Het
Fam208a C T 14: 27,461,750 T722I probably benign Het
Fut9 A G 4: 25,620,811 M1T probably null Het
Galnt5 A G 2: 58,024,625 N584S possibly damaging Het
Gbp3 T C 3: 142,567,772 V360A probably damaging Het
Gdf6 G A 4: 9,859,977 C353Y probably damaging Het
Gm13089 A T 4: 143,698,503 D123E probably benign Het
Hace1 A G 10: 45,648,869 T244A probably damaging Het
Hr T C 14: 70,559,657 I500T probably benign Het
Ifnl2 A T 7: 28,509,282 L115Q probably damaging Het
Iigp1 T C 18: 60,389,824 F5L probably benign Het
Inhbb A G 1: 119,417,416 L381P probably damaging Het
Irx3 A T 8: 91,801,093 S50T probably benign Het
Ivns1abp C T 1: 151,360,145 T363I probably benign Het
Izumo1 A T 7: 45,622,899 T35S probably benign Het
Kank4 A G 4: 98,777,105 S651P probably damaging Het
Kit T C 5: 75,610,879 V232A probably benign Het
Klhl11 T C 11: 100,463,714 Y427C probably damaging Het
Laptm4b T A 15: 34,258,689 N36K probably damaging Het
Lrrk1 T C 7: 66,266,615 probably null Het
Mamdc4 G T 2: 25,564,193 Q1042K probably benign Het
Mical2 A G 7: 112,321,440 probably null Het
Ms4a3 C A 19: 11,631,361 V176F possibly damaging Het
Myo3a A C 2: 22,396,299 E626D possibly damaging Het
Myo3a T C 2: 22,333,513 V427A probably benign Het
Nckap5 A T 1: 126,027,288 L509* probably null Het
Ndufa5 A T 6: 24,519,249 D64E possibly damaging Het
Nedd4l T C 18: 65,208,461 Y753H probably damaging Het
Nynrin T C 14: 55,872,761 V1775A probably damaging Het
Olfr141 A G 2: 86,806,861 L46S probably damaging Het
Olfr292 T C 7: 86,694,876 V140A possibly damaging Het
Olfr694 A T 7: 106,688,998 H244Q probably damaging Het
Olfr735 T C 14: 50,345,926 Y141C probably damaging Het
Olfr823 G A 10: 130,112,580 S70F probably damaging Het
Oplah A G 15: 76,302,992 S570P probably benign Het
Osbpl11 C A 16: 33,234,444 Y632* probably null Het
Osbpl5 A T 7: 143,694,821 L644Q probably damaging Het
Pcdhb19 T C 18: 37,497,952 W267R probably benign Het
Pkhd1l1 A C 15: 44,467,424 S132R possibly damaging Het
Ptpn13 T A 5: 103,556,145 S1348T probably benign Het
Rc3h1 T A 1: 160,930,135 W8R probably damaging Het
Rgs3 T G 4: 62,625,936 V315G probably damaging Het
Rora T A 9: 69,361,869 M82K probably damaging Het
Rph3al T C 11: 75,908,969 I55V probably benign Het
Sag T C 1: 87,812,991 V45A probably damaging Het
Scn3a T C 2: 65,536,510 E56G probably damaging Het
Sptbn1 A G 11: 30,138,979 L748S probably damaging Het
Stard9 A T 2: 120,706,306 D4186V probably damaging Het
Stk39 T C 2: 68,366,167 E306G probably damaging Het
Sycp1 C A 3: 102,898,849 probably null Het
Taf2 A C 15: 55,060,050 L277R probably damaging Het
Tbc1d23 T A 16: 57,173,106 I566F possibly damaging Het
Tekt5 T C 16: 10,361,304 T400A possibly damaging Het
Tgfbrap1 T C 1: 43,060,141 H401R probably benign Het
Tie1 T A 4: 118,476,147 I841L possibly damaging Het
Tln1 T G 4: 43,544,645 T1095P possibly damaging Het
Tmem147 A G 7: 30,728,102 Y72H probably benign Het
Tnfaip2 A G 12: 111,453,507 N691S probably benign Het
Trim24 G A 6: 37,957,783 C811Y probably damaging Het
Trim30b T A 7: 104,357,976 probably benign Het
Trpc4 T G 3: 54,194,768 L29R probably damaging Het
Trpm6 A T 19: 18,825,862 I890F probably damaging Het
Ttc23l C T 15: 10,504,536 E442K probably benign Het
Uggt2 A G 14: 119,095,336 V62A probably damaging Het
Ugt1a6a C A 1: 88,138,884 S137R probably benign Het
Unc13a A G 8: 71,658,467 Y367H probably damaging Het
Vmn2r49 A G 7: 9,976,306 I833T probably benign Het
Vmn2r7 T C 3: 64,716,479 D231G probably benign Het
Ythdc2 A T 18: 44,864,357 M994L probably benign Het
Zcchc6 A T 13: 59,799,782 C506* probably null Het
Zfp804a G A 2: 82,257,588 S587N probably damaging Het
Zswim2 A G 2: 83,923,659 I219T probably benign Het
Other mutations in Sec24c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Sec24c APN 14 20693203 missense probably benign 0.03
IGL00574:Sec24c APN 14 20692395 missense probably damaging 0.99
IGL01514:Sec24c APN 14 20682771 missense possibly damaging 0.78
IGL01924:Sec24c APN 14 20689689 missense probably damaging 0.96
IGL02094:Sec24c APN 14 20688402 missense probably damaging 1.00
IGL02677:Sec24c APN 14 20689642 missense probably damaging 0.98
IGL02871:Sec24c APN 14 20692882 missense probably benign
Kahuna UTSW 14 20690773 missense probably damaging 0.99
R0010:Sec24c UTSW 14 20689261 unclassified probably benign
R0335:Sec24c UTSW 14 20688715 splice site probably null
R0487:Sec24c UTSW 14 20683399 missense probably benign 0.01
R0626:Sec24c UTSW 14 20688437 missense probably damaging 1.00
R0734:Sec24c UTSW 14 20693745 missense probably damaging 1.00
R0854:Sec24c UTSW 14 20689340 missense probably damaging 1.00
R1036:Sec24c UTSW 14 20692897 missense probably benign 0.14
R1405:Sec24c UTSW 14 20692525 splice site probably null
R1405:Sec24c UTSW 14 20692525 splice site probably null
R1702:Sec24c UTSW 14 20686573 missense probably null
R1765:Sec24c UTSW 14 20688854 unclassified probably benign
R1913:Sec24c UTSW 14 20689111 missense probably benign 0.06
R1920:Sec24c UTSW 14 20686887 missense probably damaging 0.99
R2084:Sec24c UTSW 14 20691279 missense probably benign 0.00
R3778:Sec24c UTSW 14 20683307 missense possibly damaging 0.63
R4383:Sec24c UTSW 14 20690773 missense probably damaging 0.99
R4385:Sec24c UTSW 14 20690773 missense probably damaging 0.99
R4659:Sec24c UTSW 14 20683144 missense probably damaging 0.99
R4798:Sec24c UTSW 14 20693712 missense probably damaging 1.00
R4872:Sec24c UTSW 14 20693745 missense probably damaging 1.00
R5210:Sec24c UTSW 14 20691804 missense probably damaging 1.00
R5345:Sec24c UTSW 14 20693220 missense probably benign 0.00
R5610:Sec24c UTSW 14 20691825 missense probably damaging 1.00
R5614:Sec24c UTSW 14 20682738 missense possibly damaging 0.92
R5646:Sec24c UTSW 14 20679573 missense probably benign 0.01
R6460:Sec24c UTSW 14 20690800 missense probably damaging 1.00
R7181:Sec24c UTSW 14 20689333 missense probably damaging 1.00
R8228:Sec24c UTSW 14 20689907 missense probably benign 0.05
R8512:Sec24c UTSW 14 20690852 missense possibly damaging 0.67
R8679:Sec24c UTSW 14 20692859 missense possibly damaging 0.89
R9340:Sec24c UTSW 14 20679530 missense probably benign 0.00
RF010:Sec24c UTSW 14 20688715 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCATTTGTTACTGGTGTACGGGGAC -3'
(R):5'- CACAAAGTAGCTTGTTGGCCTTTGC -3'

Sequencing Primer
(F):5'- GTCCTTCAGGGTCTAAAAGCTACTG -3'
(R):5'- TCCTAACCACTGCTACCAGG -3'
Posted On 2013-07-11