Incidental Mutation 'R7019:Dlec1'
ID545514
Institutional Source Beutler Lab
Gene Symbol Dlec1
Ensembl Gene ENSMUSG00000038060
Gene Namedeleted in lung and esophageal cancer 1
SynonymsD630005C06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7019 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location119102478-119148246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119112422 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 292 (P292L)
Ref Sequence ENSEMBL: ENSMUSP00000052645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055775] [ENSMUST00000140326] [ENSMUST00000165231]
Predicted Effect probably benign
Transcript: ENSMUST00000055775
AA Change: P292L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000052645
Gene: ENSMUSG00000038060
AA Change: P292L

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140326
AA Change: P292L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000122380
Gene: ENSMUSG00000038060
AA Change: P292L

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165231
AA Change: P292L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000128874
Gene: ENSMUSG00000038060
AA Change: P292L

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1333 1354 N/A INTRINSIC
Meta Mutation Damage Score 0.1116 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytogenetic location of this gene is 3p21.3, and it is located in a region that is commonly deleted in a variety of malignancies. Down-regulation of this gene has been observed in several human cancers including lung, esophageal, renal tumors, and head and neck squamous cell carcinoma. In some cases, reduced expression of this gene in tumor cells is a result of aberrant promoter methylation. Several alternatively spliced transcripts have been observed that contain disrupted coding regions and likely encode nonfunctional proteins.[provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A T 16: 8,618,531 K414* probably null Het
Aco1 T A 4: 40,186,376 I596N probably damaging Het
Adgre1 A C 17: 57,410,945 D319A probably damaging Het
BC067074 C T 13: 113,351,750 T102I probably benign Het
Birc6 T C 17: 74,609,345 V445A probably benign Het
Btd A C 14: 31,667,105 Q261P probably damaging Het
Btd G T 14: 31,667,106 Q261H possibly damaging Het
C7 T A 15: 5,045,682 Y176F probably benign Het
Ccdc102a T C 8: 94,909,803 S287G probably benign Het
Ccdc178 T A 18: 22,150,438 T12S probably benign Het
Cnga4 G T 7: 105,405,829 A104S probably benign Het
Col10a1 G T 10: 34,394,951 L306F probably damaging Het
Cpne5 T C 17: 29,226,222 D36G probably damaging Het
Csmd2 G A 4: 128,369,063 D681N Het
Cstl1 A G 2: 148,755,303 M75V probably benign Het
Cyp26a1 T C 19: 37,698,812 L149P probably damaging Het
D630045J12Rik T G 6: 38,194,635 E866A probably benign Het
Dpp3 T G 19: 4,916,789 E402A possibly damaging Het
Egf T C 3: 129,718,064 probably null Het
Epha5 T C 5: 84,416,462 Q15R possibly damaging Het
Esyt3 A G 9: 99,315,285 F831L probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fut7 A G 2: 25,425,780 D350G probably benign Het
Gab1 C A 8: 80,784,817 E466D probably damaging Het
Glrp1 A T 1: 88,503,168 M160K unknown Het
Gngt1 T C 6: 3,994,088 probably null Het
Gprc6a A T 10: 51,631,412 V7E possibly damaging Het
Idh3b A T 2: 130,280,966 V301D probably damaging Het
Ifi202b A C 1: 173,963,958 C385G probably benign Het
Ilvbl T A 10: 78,579,086 L261Q probably damaging Het
Irx6 T A 8: 92,678,734 L410Q probably damaging Het
Ism2 T C 12: 87,299,663 M15V unknown Het
Itih5 C A 2: 10,190,327 R177S probably damaging Het
Klra3 C T 6: 130,327,124 G202R probably damaging Het
Krt7 T C 15: 101,413,970 V103A probably damaging Het
Lama3 T C 18: 12,528,418 S2145P probably damaging Het
Mlph A G 1: 90,941,706 R477G probably damaging Het
Mybpc1 T A 10: 88,543,719 L653F probably damaging Het
Myrfl A G 10: 116,781,947 probably null Het
Myrip T G 9: 120,422,507 L232R probably damaging Het
Nrd1 A T 4: 109,028,802 H126L probably benign Het
Olfr251 T A 9: 38,378,802 L307Q possibly damaging Het
Olfr469 G T 7: 107,823,158 L104I probably benign Het
Olfr722 A T 14: 49,895,667 I45N probably damaging Het
Pcdhb10 T A 18: 37,413,003 N377K probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Prkdc A C 16: 15,769,966 I2572L probably benign Het
Ptpro C A 6: 137,380,478 D322E probably benign Het
R3hcc1 A G 14: 69,704,125 I332T probably damaging Het
Rab8a T C 8: 72,161,383 F9L probably damaging Het
Ranbp3l A T 15: 9,057,160 K165N probably damaging Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rsad2 T A 12: 26,456,419 M1L possibly damaging Het
Tymp A T 15: 89,376,281 probably null Het
Vmn1r104 A G 7: 20,534,566 M244V probably benign Het
Vmn1r232 G A 17: 20,913,285 T351M possibly damaging Het
Vmn2r50 A G 7: 10,050,245 Y101H probably benign Het
Vmn2r57 A G 7: 41,428,665 L123P probably damaging Het
Wdr17 T C 8: 54,681,453 N331D probably damaging Het
Wdr47 C T 3: 108,614,355 Q89* probably null Het
Zcchc4 A T 5: 52,784,033 T57S probably benign Het
Other mutations in Dlec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Dlec1 APN 9 119102785 missense probably benign 0.11
IGL01137:Dlec1 APN 9 119137311 missense probably damaging 1.00
IGL01338:Dlec1 APN 9 119120911 missense probably damaging 1.00
IGL01652:Dlec1 APN 9 119143907 missense probably benign 0.01
IGL01923:Dlec1 APN 9 119128114 splice site probably null
IGL02186:Dlec1 APN 9 119143627 missense probably benign 0.00
IGL02597:Dlec1 APN 9 119134536 missense probably damaging 0.99
IGL02667:Dlec1 APN 9 119127466 missense probably benign 0.23
IGL02718:Dlec1 APN 9 119137286 missense probably benign 0.01
IGL02731:Dlec1 APN 9 119147120 missense probably benign 0.00
IGL02831:Dlec1 APN 9 119143915 missense probably damaging 1.00
IGL03390:Dlec1 APN 9 119123220 missense probably benign 0.00
I2288:Dlec1 UTSW 9 119143601 missense probably damaging 1.00
R0109:Dlec1 UTSW 9 119105824 missense probably damaging 1.00
R0144:Dlec1 UTSW 9 119142866 missense probably benign
R0554:Dlec1 UTSW 9 119115002 missense probably benign 0.44
R0611:Dlec1 UTSW 9 119112099 missense probably benign 0.01
R1344:Dlec1 UTSW 9 119130017 missense probably benign 0.09
R1467:Dlec1 UTSW 9 119128003 splice site probably benign
R1467:Dlec1 UTSW 9 119142578 missense probably damaging 1.00
R1467:Dlec1 UTSW 9 119142578 missense probably damaging 1.00
R1539:Dlec1 UTSW 9 119127450 missense probably benign 0.00
R1768:Dlec1 UTSW 9 119146007 splice site probably null
R1809:Dlec1 UTSW 9 119136699 missense probably benign 0.00
R1830:Dlec1 UTSW 9 119138790 missense probably benign 0.00
R1901:Dlec1 UTSW 9 119102644 missense probably damaging 0.99
R2060:Dlec1 UTSW 9 119112086 missense probably damaging 1.00
R2092:Dlec1 UTSW 9 119121844 missense possibly damaging 0.87
R2237:Dlec1 UTSW 9 119138191 critical splice donor site probably null
R2983:Dlec1 UTSW 9 119146173 missense probably benign 0.00
R3117:Dlec1 UTSW 9 119143903 unclassified probably null
R3816:Dlec1 UTSW 9 119124843 missense probably damaging 1.00
R3826:Dlec1 UTSW 9 119143061 splice site probably benign
R3965:Dlec1 UTSW 9 119128581 missense probably benign 0.01
R4023:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4024:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4026:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4272:Dlec1 UTSW 9 119143163 missense probably damaging 0.98
R4545:Dlec1 UTSW 9 119128078 missense probably damaging 0.99
R4546:Dlec1 UTSW 9 119128078 missense probably damaging 0.99
R4601:Dlec1 UTSW 9 119147134 critical splice donor site probably null
R4695:Dlec1 UTSW 9 119143153 missense probably benign 0.00
R4996:Dlec1 UTSW 9 119146050 missense probably damaging 1.00
R5321:Dlec1 UTSW 9 119112601 missense probably benign 0.02
R5521:Dlec1 UTSW 9 119143401 missense possibly damaging 0.92
R5650:Dlec1 UTSW 9 119143594 nonsense probably null
R5825:Dlec1 UTSW 9 119142968 missense probably damaging 1.00
R5941:Dlec1 UTSW 9 119126312 missense probably damaging 0.98
R6056:Dlec1 UTSW 9 119121923 missense probably damaging 0.98
R6111:Dlec1 UTSW 9 119102624 missense possibly damaging 0.59
R6156:Dlec1 UTSW 9 119110213 critical splice donor site probably null
R6160:Dlec1 UTSW 9 119143319 missense probably benign 0.02
R6195:Dlec1 UTSW 9 119137253 missense probably benign 0.00
R6364:Dlec1 UTSW 9 119121871 missense possibly damaging 0.84
R6480:Dlec1 UTSW 9 119147690 missense probably benign 0.34
R6808:Dlec1 UTSW 9 119126174 missense probably benign 0.01
R6813:Dlec1 UTSW 9 119112102 missense probably benign 0.02
R7048:Dlec1 UTSW 9 119143404 splice site probably null
R7187:Dlec1 UTSW 9 119112146 missense probably benign 0.14
R7230:Dlec1 UTSW 9 119124538 intron probably null
R7585:Dlec1 UTSW 9 119142751 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTCCATCTCGAAGGCCAAAG -3'
(R):5'- AGGGATGCTCTTCTCTCTGG -3'

Sequencing Primer
(F):5'- GACCACAGATTCTGTCAAGGTTAG -3'
(R):5'- TCTCTGGCTTGCTCAAAGGGAC -3'
Posted On2019-05-13