Incidental Mutation 'R7019:Btd'
ID545526
Institutional Source Beutler Lab
Gene Symbol Btd
Ensembl Gene ENSMUSG00000021900
Gene Namebiotinidase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R7019 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location31641028-31668579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 31667105 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 261 (Q261P)
Ref Sequence ENSEMBL: ENSMUSP00000087608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090147]
Predicted Effect probably damaging
Transcript: ENSMUST00000090147
AA Change: Q261P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087608
Gene: ENSMUSG00000021900
AA Change: Q261P

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:CN_hydrolase 63 287 3.9e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions to recycle protein-bound biotin by cleaving biocytin (biotin-epsilon-lysine), a normal product of carboxylase degradation, resulting in regeneration of free biotin. The encoded protein has also been shown to have biotinyl transferase activity. Mutations in this gene are associated with biotinidase deficiency. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit behavioral/neurological defects, weakness, bone loss, weight loss, and alopecia when fed a biotin-deprived diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A T 16: 8,618,531 K414* probably null Het
Aco1 T A 4: 40,186,376 I596N probably damaging Het
Adgre1 A C 17: 57,410,945 D319A probably damaging Het
BC067074 C T 13: 113,351,750 T102I probably benign Het
Birc6 T C 17: 74,609,345 V445A probably benign Het
C7 T A 15: 5,045,682 Y176F probably benign Het
Ccdc102a T C 8: 94,909,803 S287G probably benign Het
Ccdc178 T A 18: 22,150,438 T12S probably benign Het
Cnga4 G T 7: 105,405,829 A104S probably benign Het
Col10a1 G T 10: 34,394,951 L306F probably damaging Het
Cpne5 T C 17: 29,226,222 D36G probably damaging Het
Csmd2 G A 4: 128,369,063 D681N Het
Cstl1 A G 2: 148,755,303 M75V probably benign Het
Cyp26a1 T C 19: 37,698,812 L149P probably damaging Het
D630045J12Rik T G 6: 38,194,635 E866A probably benign Het
Dlec1 C T 9: 119,112,422 P292L probably benign Het
Dpp3 T G 19: 4,916,789 E402A possibly damaging Het
Egf T C 3: 129,718,064 probably null Het
Epha5 T C 5: 84,416,462 Q15R possibly damaging Het
Esyt3 A G 9: 99,315,285 F831L probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fut7 A G 2: 25,425,780 D350G probably benign Het
Gab1 C A 8: 80,784,817 E466D probably damaging Het
Glrp1 A T 1: 88,503,168 M160K unknown Het
Gngt1 T C 6: 3,994,088 probably null Het
Gprc6a A T 10: 51,631,412 V7E possibly damaging Het
Idh3b A T 2: 130,280,966 V301D probably damaging Het
Ifi202b A C 1: 173,963,958 C385G probably benign Het
Ilvbl T A 10: 78,579,086 L261Q probably damaging Het
Irx6 T A 8: 92,678,734 L410Q probably damaging Het
Ism2 T C 12: 87,299,663 M15V unknown Het
Itih5 C A 2: 10,190,327 R177S probably damaging Het
Klra3 C T 6: 130,327,124 G202R probably damaging Het
Krt7 T C 15: 101,413,970 V103A probably damaging Het
Lama3 T C 18: 12,528,418 S2145P probably damaging Het
Mlph A G 1: 90,941,706 R477G probably damaging Het
Mybpc1 T A 10: 88,543,719 L653F probably damaging Het
Myrfl A G 10: 116,781,947 probably null Het
Myrip T G 9: 120,422,507 L232R probably damaging Het
Nrd1 A T 4: 109,028,802 H126L probably benign Het
Olfr251 T A 9: 38,378,802 L307Q possibly damaging Het
Olfr469 G T 7: 107,823,158 L104I probably benign Het
Olfr722 A T 14: 49,895,667 I45N probably damaging Het
Pcdhb10 T A 18: 37,413,003 N377K probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Prkdc A C 16: 15,769,966 I2572L probably benign Het
Ptpro C A 6: 137,380,478 D322E probably benign Het
R3hcc1 A G 14: 69,704,125 I332T probably damaging Het
Rab8a T C 8: 72,161,383 F9L probably damaging Het
Ranbp3l A T 15: 9,057,160 K165N probably damaging Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rsad2 T A 12: 26,456,419 M1L possibly damaging Het
Tymp A T 15: 89,376,281 probably null Het
Vmn1r104 A G 7: 20,534,566 M244V probably benign Het
Vmn1r232 G A 17: 20,913,285 T351M possibly damaging Het
Vmn2r50 A G 7: 10,050,245 Y101H probably benign Het
Vmn2r57 A G 7: 41,428,665 L123P probably damaging Het
Wdr17 T C 8: 54,681,453 N331D probably damaging Het
Wdr47 C T 3: 108,614,355 Q89* probably null Het
Zcchc4 A T 5: 52,784,033 T57S probably benign Het
Other mutations in Btd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Btd APN 14 31667776 missense probably benign 0.00
IGL02728:Btd APN 14 31667362 missense probably benign 0.00
IGL02965:Btd APN 14 31667236 missense probably damaging 1.00
R1503:Btd UTSW 14 31667655 missense probably damaging 1.00
R1662:Btd UTSW 14 31666790 missense probably damaging 1.00
R1817:Btd UTSW 14 31662289 missense possibly damaging 0.95
R1868:Btd UTSW 14 31667309 missense probably benign 0.13
R2225:Btd UTSW 14 31667060 missense probably benign 0.00
R2418:Btd UTSW 14 31641136 critical splice donor site probably null
R4660:Btd UTSW 14 31667803 missense probably benign 0.00
R4727:Btd UTSW 14 31662321 missense probably benign 0.01
R4923:Btd UTSW 14 31662087 missense possibly damaging 0.92
R5703:Btd UTSW 14 31667047 nonsense probably null
R5806:Btd UTSW 14 31667512 missense probably benign
R6110:Btd UTSW 14 31641108 unclassified probably benign
R6119:Btd UTSW 14 31641108 unclassified probably benign
R6120:Btd UTSW 14 31641108 unclassified probably benign
R7019:Btd UTSW 14 31667106 missense possibly damaging 0.88
R7021:Btd UTSW 14 31667831 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGTCGACCGCTACCGTAAG -3'
(R):5'- GTGGCTACCTGGGCAATTATAAG -3'

Sequencing Primer
(F):5'- ACAACCTGTACTTTGAGGCG -3'
(R):5'- CTACCTGGGCAATTATAAGGTGACC -3'
Posted On2019-05-13