Incidental Mutation 'R7020:Pms1'
ID545544
Institutional Source Beutler Lab
Gene Symbol Pms1
Ensembl Gene ENSMUSG00000026098
Gene NamePMS1 homolog 1, mismatch repair system component
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7020 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location53189187-53297018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53189382 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 902 (H902Q)
Ref Sequence ENSEMBL: ENSMUSP00000027267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027267] [ENSMUST00000072235] [ENSMUST00000190748]
Predicted Effect probably damaging
Transcript: ENSMUST00000027267
AA Change: H902Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027267
Gene: ENSMUSG00000026098
AA Change: H902Q

DomainStartEndE-ValueType
HATPase_c 16 151 3.84e-1 SMART
DNA_mis_repair 210 338 2.46e-25 SMART
low complexity region 457 474 N/A INTRINSIC
HMG 557 627 1.42e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072235
SMART Domains Protein: ENSMUSP00000072089
Gene: ENSMUSG00000060715

DomainStartEndE-ValueType
coiled coil region 38 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190748
SMART Domains Protein: ENSMUSP00000139938
Gene: ENSMUSG00000060715

DomainStartEndE-ValueType
coiled coil region 38 68 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the DNA mismatch repair mutL/hexB family. This protein is thought to be involved in the repair of DNA mismatches, and it can form heterodimers with MLH1, a known DNA mismatch repair protein. Mutations in this gene cause hereditary nonpolyposis colorectal cancer type 3 (HNPCC3) either alone or in combination with mutations in other genes involved in the HNPCC phenotype, which is also known as Lynch syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a modest increase in DNA mismatch repair errors, primarily single base pair substitutions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,668,541 G188R probably damaging Het
Abhd3 T C 18: 10,645,127 Y384C probably damaging Het
Cd209b T A 8: 3,918,783 E282V probably damaging Het
Cep350 A C 1: 155,928,331 L1002W probably damaging Het
Clcn1 T C 6: 42,298,820 V292A probably damaging Het
Clcn7 T C 17: 25,146,351 I107T possibly damaging Het
Cntrob A G 11: 69,303,092 probably null Het
Crb1 A T 1: 139,231,603 S1294T possibly damaging Het
Cst13 T G 2: 148,823,209 Y41* probably null Het
Gp1ba A G 11: 70,640,313 probably benign Het
Gucy2e A T 11: 69,232,793 L427I probably benign Het
Gucy2g A G 19: 55,233,050 S340P probably damaging Het
Herc1 A G 9: 66,486,078 T4080A probably benign Het
Iglon5 A T 7: 43,476,895 C195S probably damaging Het
Itgae A G 11: 73,111,369 T100A probably damaging Het
Jarid2 C T 13: 44,884,824 S205L probably damaging Het
Macrod2 A T 2: 142,389,875 *424C probably null Het
Map2k6 A T 11: 110,506,714 probably benign Het
Muc4 A T 16: 32,751,810 K563* probably null Het
Myh7b T C 2: 155,631,751 I1568T possibly damaging Het
Myo15b G A 11: 115,866,667 W1114* probably null Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Notch1 T C 2: 26,481,574 T288A possibly damaging Het
Npc1 C T 18: 12,198,537 G859R probably damaging Het
Olfm2 T A 9: 20,668,568 R326W probably damaging Het
Olfr1000 A G 2: 85,608,632 S93P probably benign Het
Olfr1043 A G 2: 86,162,019 I310T probably benign Het
Olfr13 T C 6: 43,174,162 Y59H possibly damaging Het
Ovol1 G A 19: 5,560,233 P23L probably damaging Het
Pappa2 C A 1: 158,848,009 V1056F probably damaging Het
Pik3ca T C 3: 32,436,279 L25S probably damaging Het
Pla2r1 T C 2: 60,447,399 H860R possibly damaging Het
Ptgs1 T G 2: 36,251,029 L496R probably damaging Het
Ralgapa2 A T 2: 146,346,718 Y1381* probably null Het
Rtl1 T C 12: 109,592,315 Q1030R possibly damaging Het
Ryr3 T A 2: 112,753,078 Y2816F probably benign Het
Sh2b2 T C 5: 136,224,299 T340A possibly damaging Het
Slc30a5 T A 13: 100,824,913 probably null Het
Spta1 T C 1: 174,209,352 L1143P probably damaging Het
St8sia5 T C 18: 77,246,180 I178T probably damaging Het
Tap2 A G 17: 34,214,414 N517S possibly damaging Het
Tcp11 A G 17: 28,071,705 Y227H possibly damaging Het
Usp34 A G 11: 23,393,954 D1411G probably benign Het
Vmn2r105 A G 17: 20,209,074 L580P probably damaging Het
Wdr19 A G 5: 65,256,314 E1200G probably damaging Het
Xirp2 T C 2: 67,525,569 V3558A probably benign Het
Xpo7 T C 14: 70,666,023 N1082S probably benign Het
Zbtb49 A T 5: 38,213,367 L390* probably null Het
Zfp639 C A 3: 32,520,112 D295E probably damaging Het
Other mutations in Pms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Pms1 APN 1 53206556 splice site probably benign
IGL00937:Pms1 APN 1 53275251 missense possibly damaging 0.74
IGL01505:Pms1 APN 1 53206971 missense probably benign
IGL02109:Pms1 APN 1 53207409 missense probably damaging 0.96
IGL02245:Pms1 APN 1 53207360 missense probably damaging 1.00
IGL02273:Pms1 APN 1 53207997 missense probably damaging 1.00
IGL02339:Pms1 APN 1 53275165 missense possibly damaging 0.78
R0157:Pms1 UTSW 1 53195037 nonsense probably null
R0530:Pms1 UTSW 1 53196813 unclassified probably null
R1398:Pms1 UTSW 1 53207276 missense possibly damaging 0.88
R1817:Pms1 UTSW 1 53206969 missense probably benign 0.02
R1831:Pms1 UTSW 1 53207211 missense probably benign 0.00
R1838:Pms1 UTSW 1 53192098 critical splice donor site probably null
R1867:Pms1 UTSW 1 53189387 missense probably benign 0.36
R1874:Pms1 UTSW 1 53207233 missense probably benign 0.16
R1939:Pms1 UTSW 1 53196976 missense probably damaging 1.00
R1991:Pms1 UTSW 1 53282042 missense probably damaging 1.00
R1993:Pms1 UTSW 1 53195015 missense probably benign
R1995:Pms1 UTSW 1 53195015 missense probably benign
R2049:Pms1 UTSW 1 53281988 missense probably damaging 0.99
R2058:Pms1 UTSW 1 53275168 missense probably benign 0.00
R2140:Pms1 UTSW 1 53281988 missense probably damaging 0.99
R4078:Pms1 UTSW 1 53267789 unclassified probably null
R4608:Pms1 UTSW 1 53194938 missense possibly damaging 0.80
R4668:Pms1 UTSW 1 53189474 nonsense probably null
R5164:Pms1 UTSW 1 53207640 missense probably damaging 0.99
R5200:Pms1 UTSW 1 53206757 missense probably benign 0.00
R5397:Pms1 UTSW 1 53192120 nonsense probably null
R5745:Pms1 UTSW 1 53207702 nonsense probably null
R6440:Pms1 UTSW 1 53195021 missense probably damaging 0.98
R6445:Pms1 UTSW 1 53192194 missense possibly damaging 0.77
R6802:Pms1 UTSW 1 53206792 missense probably benign 0.06
R6975:Pms1 UTSW 1 53189431 missense probably damaging 0.99
R7037:Pms1 UTSW 1 53207611 missense possibly damaging 0.95
R7199:Pms1 UTSW 1 53256730 missense probably benign 0.02
R7417:Pms1 UTSW 1 53197072 missense probably benign 0.00
R7587:Pms1 UTSW 1 53207316 missense probably benign 0.00
R7716:Pms1 UTSW 1 53207608 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGCCTACAACCTACAATTGG -3'
(R):5'- AATAGTGTGTCTCTTCTTCAGGGTC -3'

Sequencing Primer
(F):5'- GCCTACAACCTACAATTGGTTTGAAG -3'
(R):5'- CTTCAGGGTCTATCAGGATGAAAC -3'
Posted On2019-05-13