Incidental Mutation 'R7020:Olfr1000'
ID545553
Institutional Source Beutler Lab
Gene Symbol Olfr1000
Ensembl Gene ENSMUSG00000075215
Gene Nameolfactory receptor 1000
SynonymsMOR175-9, GA_x6K02T2Q125-47087719-47086775
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7020 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85607037-85611903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85608632 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 93 (S93P)
Ref Sequence ENSEMBL: ENSMUSP00000150731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099921] [ENSMUST00000213837] [ENSMUST00000216571]
Predicted Effect probably benign
Transcript: ENSMUST00000099921
AA Change: S93P

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097505
Gene: ENSMUSG00000075215
AA Change: S93P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.1e-49 PFAM
Pfam:7tm_1 41 290 2.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213837
AA Change: S93P

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000216571
AA Change: S93P

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,668,541 G188R probably damaging Het
Abhd3 T C 18: 10,645,127 Y384C probably damaging Het
Cd209b T A 8: 3,918,783 E282V probably damaging Het
Cep350 A C 1: 155,928,331 L1002W probably damaging Het
Clcn1 T C 6: 42,298,820 V292A probably damaging Het
Clcn7 T C 17: 25,146,351 I107T possibly damaging Het
Cntrob A G 11: 69,303,092 probably null Het
Crb1 A T 1: 139,231,603 S1294T possibly damaging Het
Cst13 T G 2: 148,823,209 Y41* probably null Het
Gp1ba A G 11: 70,640,313 probably benign Het
Gucy2e A T 11: 69,232,793 L427I probably benign Het
Gucy2g A G 19: 55,233,050 S340P probably damaging Het
Herc1 A G 9: 66,486,078 T4080A probably benign Het
Iglon5 A T 7: 43,476,895 C195S probably damaging Het
Itgae A G 11: 73,111,369 T100A probably damaging Het
Jarid2 C T 13: 44,884,824 S205L probably damaging Het
Macrod2 A T 2: 142,389,875 *424C probably null Het
Map2k6 A T 11: 110,506,714 probably benign Het
Muc4 A T 16: 32,751,810 K563* probably null Het
Myh7b T C 2: 155,631,751 I1568T possibly damaging Het
Myo15b G A 11: 115,866,667 W1114* probably null Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Notch1 T C 2: 26,481,574 T288A possibly damaging Het
Npc1 C T 18: 12,198,537 G859R probably damaging Het
Olfm2 T A 9: 20,668,568 R326W probably damaging Het
Olfr1043 A G 2: 86,162,019 I310T probably benign Het
Olfr13 T C 6: 43,174,162 Y59H possibly damaging Het
Ovol1 G A 19: 5,560,233 P23L probably damaging Het
Pappa2 C A 1: 158,848,009 V1056F probably damaging Het
Pik3ca T C 3: 32,436,279 L25S probably damaging Het
Pla2r1 T C 2: 60,447,399 H860R possibly damaging Het
Pms1 A T 1: 53,189,382 H902Q probably damaging Het
Ptgs1 T G 2: 36,251,029 L496R probably damaging Het
Ralgapa2 A T 2: 146,346,718 Y1381* probably null Het
Rtl1 T C 12: 109,592,315 Q1030R possibly damaging Het
Ryr3 T A 2: 112,753,078 Y2816F probably benign Het
Sh2b2 T C 5: 136,224,299 T340A possibly damaging Het
Slc30a5 T A 13: 100,824,913 probably null Het
Spta1 T C 1: 174,209,352 L1143P probably damaging Het
St8sia5 T C 18: 77,246,180 I178T probably damaging Het
Tap2 A G 17: 34,214,414 N517S possibly damaging Het
Tcp11 A G 17: 28,071,705 Y227H possibly damaging Het
Usp34 A G 11: 23,393,954 D1411G probably benign Het
Vmn2r105 A G 17: 20,209,074 L580P probably damaging Het
Wdr19 A G 5: 65,256,314 E1200G probably damaging Het
Xirp2 T C 2: 67,525,569 V3558A probably benign Het
Xpo7 T C 14: 70,666,023 N1082S probably benign Het
Zbtb49 A T 5: 38,213,367 L390* probably null Het
Zfp639 C A 3: 32,520,112 D295E probably damaging Het
Other mutations in Olfr1000
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Olfr1000 APN 2 85608761 missense probably benign
IGL01872:Olfr1000 APN 2 85608329 missense probably benign
IGL01955:Olfr1000 APN 2 85608707 missense probably benign 0.12
IGL02132:Olfr1000 APN 2 85608320 missense probably benign 0.00
IGL02139:Olfr1000 APN 2 85608230 nonsense probably null
IGL02717:Olfr1000 APN 2 85608772 missense probably damaging 1.00
IGL02950:Olfr1000 APN 2 85608157 missense possibly damaging 0.92
R1866:Olfr1000 UTSW 2 85608844 missense probably benign 0.05
R1868:Olfr1000 UTSW 2 85608065 missense probably damaging 0.98
R1869:Olfr1000 UTSW 2 85608500 missense probably benign 0.23
R2256:Olfr1000 UTSW 2 85608463 missense possibly damaging 0.81
R2919:Olfr1000 UTSW 2 85608410 missense probably benign 0.06
R4736:Olfr1000 UTSW 2 85607983 missense probably benign
R5197:Olfr1000 UTSW 2 85608447 missense probably benign 0.01
R5256:Olfr1000 UTSW 2 85608473 missense probably benign
R5367:Olfr1000 UTSW 2 85608374 missense probably damaging 0.99
R5389:Olfr1000 UTSW 2 85608283 missense probably benign
R6991:Olfr1000 UTSW 2 85608248 missense possibly damaging 0.76
R7017:Olfr1000 UTSW 2 85608329 missense probably benign
R7352:Olfr1000 UTSW 2 85608784 missense probably damaging 1.00
R7392:Olfr1000 UTSW 2 85608488 missense possibly damaging 0.61
R7586:Olfr1000 UTSW 2 85608184 missense probably damaging 0.99
R7727:Olfr1000 UTSW 2 85608407 missense possibly damaging 0.72
R8053:Olfr1000 UTSW 2 85608890 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAAAAGGTCAAAGTTGTGTGTATC -3'
(R):5'- CGTGGCATTACAGATAACCTCC -3'

Sequencing Primer
(F):5'- GGTCAAAGTTGTGTGTATCATTGTAC -3'
(R):5'- GTGGCATTACAGATAACCTCCATCAG -3'
Posted On2019-05-13