Incidental Mutation 'R7020:Macrod2'
ID545556
Institutional Source Beutler Lab
Gene Symbol Macrod2
Ensembl Gene ENSMUSG00000068205
Gene NameMACRO domain containing 2
Synonyms2900006F19Rik, 1110033L15Rik, 2610107G07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7020 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location140395309-142392966 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to T at 142389875 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Cysteine at position 424 (*424C)
Ref Sequence ENSEMBL: ENSMUSP00000105694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110064] [ENSMUST00000110067]
Predicted Effect probably benign
Transcript: ENSMUST00000110064
SMART Domains Protein: ENSMUSP00000105691
Gene: ENSMUSG00000068205

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
low complexity region 266 293 N/A INTRINSIC
low complexity region 307 319 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110067
AA Change: *424C
SMART Domains Protein: ENSMUSP00000105694
Gene: ENSMUSG00000068205
AA Change: *424C

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
A1pp 71 201 5.72e-45 SMART
Meta Mutation Damage Score 0.8577 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,668,541 G188R probably damaging Het
Abhd3 T C 18: 10,645,127 Y384C probably damaging Het
Cd209b T A 8: 3,918,783 E282V probably damaging Het
Cep350 A C 1: 155,928,331 L1002W probably damaging Het
Clcn1 T C 6: 42,298,820 V292A probably damaging Het
Clcn7 T C 17: 25,146,351 I107T possibly damaging Het
Cntrob A G 11: 69,303,092 probably null Het
Crb1 A T 1: 139,231,603 S1294T possibly damaging Het
Cst13 T G 2: 148,823,209 Y41* probably null Het
Gp1ba A G 11: 70,640,313 probably benign Het
Gucy2e A T 11: 69,232,793 L427I probably benign Het
Gucy2g A G 19: 55,233,050 S340P probably damaging Het
Herc1 A G 9: 66,486,078 T4080A probably benign Het
Iglon5 A T 7: 43,476,895 C195S probably damaging Het
Itgae A G 11: 73,111,369 T100A probably damaging Het
Jarid2 C T 13: 44,884,824 S205L probably damaging Het
Map2k6 A T 11: 110,506,714 probably benign Het
Muc4 A T 16: 32,751,810 K563* probably null Het
Myh7b T C 2: 155,631,751 I1568T possibly damaging Het
Myo15b G A 11: 115,866,667 W1114* probably null Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Notch1 T C 2: 26,481,574 T288A possibly damaging Het
Npc1 C T 18: 12,198,537 G859R probably damaging Het
Olfm2 T A 9: 20,668,568 R326W probably damaging Het
Olfr1000 A G 2: 85,608,632 S93P probably benign Het
Olfr1043 A G 2: 86,162,019 I310T probably benign Het
Olfr13 T C 6: 43,174,162 Y59H possibly damaging Het
Ovol1 G A 19: 5,560,233 P23L probably damaging Het
Pappa2 C A 1: 158,848,009 V1056F probably damaging Het
Pik3ca T C 3: 32,436,279 L25S probably damaging Het
Pla2r1 T C 2: 60,447,399 H860R possibly damaging Het
Pms1 A T 1: 53,189,382 H902Q probably damaging Het
Ptgs1 T G 2: 36,251,029 L496R probably damaging Het
Ralgapa2 A T 2: 146,346,718 Y1381* probably null Het
Rtl1 T C 12: 109,592,315 Q1030R possibly damaging Het
Ryr3 T A 2: 112,753,078 Y2816F probably benign Het
Sh2b2 T C 5: 136,224,299 T340A possibly damaging Het
Slc30a5 T A 13: 100,824,913 probably null Het
Spta1 T C 1: 174,209,352 L1143P probably damaging Het
St8sia5 T C 18: 77,246,180 I178T probably damaging Het
Tap2 A G 17: 34,214,414 N517S possibly damaging Het
Tcp11 A G 17: 28,071,705 Y227H possibly damaging Het
Usp34 A G 11: 23,393,954 D1411G probably benign Het
Vmn2r105 A G 17: 20,209,074 L580P probably damaging Het
Wdr19 A G 5: 65,256,314 E1200G probably damaging Het
Xirp2 T C 2: 67,525,569 V3558A probably benign Het
Xpo7 T C 14: 70,666,023 N1082S probably benign Het
Zbtb49 A T 5: 38,213,367 L390* probably null Het
Zfp639 C A 3: 32,520,112 D295E probably damaging Het
Other mutations in Macrod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Macrod2 APN 2 140400877 missense probably damaging 0.99
IGL00661:Macrod2 APN 2 140419904 critical splice acceptor site probably null
IGL00788:Macrod2 APN 2 142210149 splice site probably benign
IGL00840:Macrod2 APN 2 142176658 missense possibly damaging 0.53
IGL01160:Macrod2 APN 2 140825042 splice site probably benign
IGL01357:Macrod2 APN 2 142384330 missense probably damaging 1.00
IGL01453:Macrod2 APN 2 140452572 splice site probably benign
IGL01910:Macrod2 APN 2 142296565 missense probably benign 0.04
IGL02208:Macrod2 APN 2 142374276 missense possibly damaging 0.55
IGL03013:Macrod2 APN 2 141515227 missense probably benign 0.02
R0196:Macrod2 UTSW 2 142176625 missense probably damaging 1.00
R0415:Macrod2 UTSW 2 142210145 critical splice donor site probably null
R0699:Macrod2 UTSW 2 140418916 critical splice donor site probably null
R0730:Macrod2 UTSW 2 142217674 splice site probably benign
R1119:Macrod2 UTSW 2 140400906 missense probably benign 0.00
R1124:Macrod2 UTSW 2 140452627 missense probably damaging 1.00
R1422:Macrod2 UTSW 2 140419941 splice site probably null
R3707:Macrod2 UTSW 2 141810629 missense probably damaging 1.00
R3708:Macrod2 UTSW 2 141810629 missense probably damaging 1.00
R3745:Macrod2 UTSW 2 141810629 missense probably damaging 1.00
R4409:Macrod2 UTSW 2 140418857 missense possibly damaging 0.66
R4666:Macrod2 UTSW 2 142217599 missense probably damaging 0.99
R4782:Macrod2 UTSW 2 140419938 missense possibly damaging 0.81
R4885:Macrod2 UTSW 2 140420065 missense possibly damaging 0.66
R5180:Macrod2 UTSW 2 140395716 missense probably damaging 1.00
R5524:Macrod2 UTSW 2 142317943 missense possibly damaging 0.82
R5677:Macrod2 UTSW 2 142176667 missense probably damaging 1.00
R5735:Macrod2 UTSW 2 140418889 missense possibly damaging 0.66
R5750:Macrod2 UTSW 2 141515320 missense probably benign 0.41
R5770:Macrod2 UTSW 2 141232182 intron probably benign
R6029:Macrod2 UTSW 2 142318447 missense probably damaging 0.99
R6174:Macrod2 UTSW 2 140400975 start codon destroyed probably null
R6453:Macrod2 UTSW 2 142176625 missense probably damaging 1.00
R6830:Macrod2 UTSW 2 140452682 missense probably damaging 1.00
R6927:Macrod2 UTSW 2 142256521 missense probably damaging 1.00
R6932:Macrod2 UTSW 2 140419913 missense probably damaging 0.97
R7886:Macrod2 UTSW 2 141724645 missense probably damaging 1.00
R7969:Macrod2 UTSW 2 141724645 missense probably damaging 1.00
Z1176:Macrod2 UTSW 2 140706208 missense probably damaging 1.00
Z1176:Macrod2 UTSW 2 141024090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTATTTCTAGGCCTGTTTGAG -3'
(R):5'- TGAGTGCCTGAAAGATGCTAAG -3'

Sequencing Primer
(F):5'- GGACTGAGAGACATTTCAAGTGCTTC -3'
(R):5'- TGCTAAGCATGGGGCCTC -3'
Posted On2019-05-13