Mutagenetix > Incidental Mutations

Incidental Mutation 'R7020:Myh7b'

545559

Institutional Source

Beutler Lab

Gene Symbol

Myh7b

Ensembl Gene

ENSMUSG00000074652

Gene Name

myosin, heavy chain 7B, cardiac muscle, beta

Synonyms

Myh14

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7020 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

155611212-155634307 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 155631751 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1568 (I1568T)

Ref Sequence

ENSEMBL: ENSMUSP00000090672 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041059] [ENSMUST00000092995] [ENSMUST00000103140]

AlphaFold

A2AQP0

Predicted Effect

probably benign
Transcript: ENSMUST00000041059

SMART Domains

Protein: ENSMUSP00000037574
Gene: ENSMUSG00000038324

Domain	Start	End	E-Value	Type
low complexity region	2	35	N/A	INTRINSIC
low complexity region	38	53	N/A	INTRINSIC
Pfam:DUF3689	407	714	5.2e-135	PFAM
low complexity region	724	735	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092995
AA Change: I1568T

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000090672
Gene: ENSMUSG00000074652
AA Change: I1568T

Domain	Start	End	E-Value	Type
Pfam:Myosin_N	32	72	4.7e-14	PFAM
MYSc	78	786	N/A	SMART
IQ	787	809	2.6e0	SMART
Pfam:Myosin_tail_1	850	1931	5.5e-149	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000103140

SMART Domains

Protein: ENSMUSP00000099429
Gene: ENSMUSG00000038324

Domain	Start	End	E-Value	Type
low complexity region	2	35	N/A	INTRINSIC
low complexity region	38	53	N/A	INTRINSIC
Pfam:DUF3689	399	710	1.1e-138	PFAM
low complexity region	716	727	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer comprised of two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. [provided by RefSeq, Jun 2013]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	C	T	12: 110,668,541	G188R	probably damaging	Het
Abhd3	T	C	18: 10,645,127	Y384C	probably damaging	Het
Cd209b	T	A	8: 3,918,783	E282V	probably damaging	Het
Cep350	A	C	1: 155,928,331	L1002W	probably damaging	Het
Clcn1	T	C	6: 42,298,820	V292A	probably damaging	Het
Clcn7	T	C	17: 25,146,351	I107T	possibly damaging	Het
Cntrob	A	G	11: 69,303,092		probably null	Het
Crb1	A	T	1: 139,231,603	S1294T	possibly damaging	Het
Cst13	T	G	2: 148,823,209	Y41*	probably null	Het
Gp1ba	A	G	11: 70,640,313		probably benign	Het
Gucy2e	A	T	11: 69,232,793	L427I	probably benign	Het
Gucy2g	A	G	19: 55,233,050	S340P	probably damaging	Het
Herc1	A	G	9: 66,486,078	T4080A	probably benign	Het
Iglon5	A	T	7: 43,476,895	C195S	probably damaging	Het
Itgae	A	G	11: 73,111,369	T100A	probably damaging	Het
Jarid2	C	T	13: 44,884,824	S205L	probably damaging	Het
Macrod2	A	T	2: 142,389,875	*424C	probably null	Het
Map2k6	A	T	11: 110,506,714		probably benign	Het
Muc4	A	T	16: 32,751,810	K563*	probably null	Het
Myo15b	G	A	11: 115,866,667	W1114*	probably null	Het
Mypn	T	C	10: 63,192,510	Y258C	probably damaging	Het
Notch1	T	C	2: 26,481,574	T288A	possibly damaging	Het
Npc1	C	T	18: 12,198,537	G859R	probably damaging	Het
Olfm2	T	A	9: 20,668,568	R326W	probably damaging	Het
Olfr1000	A	G	2: 85,608,632	S93P	probably benign	Het
Olfr1043	A	G	2: 86,162,019	I310T	probably benign	Het
Olfr13	T	C	6: 43,174,162	Y59H	possibly damaging	Het
Ovol1	G	A	19: 5,560,233	P23L	probably damaging	Het
Pappa2	C	A	1: 158,848,009	V1056F	probably damaging	Het
Pik3ca	T	C	3: 32,436,279	L25S	probably damaging	Het
Pla2r1	T	C	2: 60,447,399	H860R	possibly damaging	Het
Pms1	A	T	1: 53,189,382	H902Q	probably damaging	Het
Ptgs1	T	G	2: 36,251,029	L496R	probably damaging	Het
Ralgapa2	A	T	2: 146,346,718	Y1381*	probably null	Het
Rtl1	T	C	12: 109,592,315	Q1030R	possibly damaging	Het
Ryr3	T	A	2: 112,753,078	Y2816F	probably benign	Het
Sh2b2	T	C	5: 136,224,299	T340A	possibly damaging	Het
Slc30a5	T	A	13: 100,824,913		probably null	Het
Spta1	T	C	1: 174,209,352	L1143P	probably damaging	Het
St8sia5	T	C	18: 77,246,180	I178T	probably damaging	Het
Tap2	A	G	17: 34,214,414	N517S	possibly damaging	Het
Tcp11	A	G	17: 28,071,705	Y227H	possibly damaging	Het
Usp34	A	G	11: 23,393,954	D1411G	probably benign	Het
Vmn2r105	A	G	17: 20,209,074	L580P	probably damaging	Het
Wdr19	A	G	5: 65,256,314	E1200G	probably damaging	Het
Xirp2	T	C	2: 67,525,569	V3558A	probably benign	Het
Xpo7	T	C	14: 70,666,023	N1082S	probably benign	Het
Zbtb49	A	T	5: 38,213,367	L390*	probably null	Het
Zfp639	C	A	3: 32,520,112	D295E	probably damaging	Het

Other mutations in Myh7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00931:Myh7b	APN	2	155630292	missense	probably damaging	0.99
IGL01604:Myh7b	APN	2	155632407	missense	probably damaging	0.96
IGL02179:Myh7b	APN	2	155614491	missense	probably benign	0.02
IGL02729:Myh7b	APN	2	155625689	missense	probably damaging	1.00
IGL02804:Myh7b	APN	2	155625723	missense	probably damaging	1.00
IGL02851:Myh7b	APN	2	155628827	missense	probably damaging	1.00
IGL02956:Myh7b	APN	2	155632903	missense	probably damaging	1.00
IGL02956:Myh7b	APN	2	155625954	missense	possibly damaging	0.95
IGL02992:Myh7b	APN	2	155621410	missense	probably damaging	0.99
IGL03060:Myh7b	APN	2	155632751	missense	probably damaging	1.00
IGL03061:Myh7b	APN	2	155620111	missense	possibly damaging	0.93
IGL03226:Myh7b	APN	2	155620483	nonsense	probably null
IGL03246:Myh7b	APN	2	155617872	missense	probably damaging	1.00
IGL03382:Myh7b	APN	2	155623479	missense	probably damaging	1.00
euclidian	UTSW	2	155633399	missense	probably benign	0.32
imaginary	UTSW	2	155632255	missense	probably benign	0.36
Irrational	UTSW	2	155630672	unclassified	probably benign
Muscoli	UTSW	2	155620118	nonsense	probably null
R0015:Myh7b	UTSW	2	155622286	missense	probably damaging	1.00
R0015:Myh7b	UTSW	2	155622286	missense	probably damaging	1.00
R0109:Myh7b	UTSW	2	155611674	missense	possibly damaging	0.92
R0309:Myh7b	UTSW	2	155630672	unclassified	probably benign
R0567:Myh7b	UTSW	2	155626398	missense	probably damaging	1.00
R0619:Myh7b	UTSW	2	155611722	missense	probably benign	0.00
R0927:Myh7b	UTSW	2	155620120	missense	probably damaging	1.00
R0973:Myh7b	UTSW	2	155620427	missense	probably benign
R0973:Myh7b	UTSW	2	155620427	missense	probably benign
R0974:Myh7b	UTSW	2	155620427	missense	probably benign
R1137:Myh7b	UTSW	2	155622714	missense	probably damaging	1.00
R1261:Myh7b	UTSW	2	155621083	missense	probably benign	0.00
R1268:Myh7b	UTSW	2	155614046	nonsense	probably null
R1537:Myh7b	UTSW	2	155631787	missense	probably damaging	0.96
R1632:Myh7b	UTSW	2	155620525	missense	probably benign	0.04
R1694:Myh7b	UTSW	2	155613193	missense	probably damaging	0.99
R1697:Myh7b	UTSW	2	155620134	missense	probably damaging	1.00
R1730:Myh7b	UTSW	2	155625672	missense	possibly damaging	0.73
R1762:Myh7b	UTSW	2	155630858	missense	probably damaging	0.96
R1783:Myh7b	UTSW	2	155625672	missense	possibly damaging	0.73
R2105:Myh7b	UTSW	2	155629457	missense	probably benign	0.00
R2140:Myh7b	UTSW	2	155620123	missense	probably damaging	1.00
R2971:Myh7b	UTSW	2	155632255	missense	probably benign	0.36
R3838:Myh7b	UTSW	2	155632989	missense	probably damaging	1.00
R4074:Myh7b	UTSW	2	155618758	missense	probably damaging	0.96
R4191:Myh7b	UTSW	2	155633399	missense	probably benign	0.32
R4689:Myh7b	UTSW	2	155630514	missense	possibly damaging	0.75
R4695:Myh7b	UTSW	2	155614177	missense	probably damaging	1.00
R4697:Myh7b	UTSW	2	155629322	missense	probably damaging	1.00
R4771:Myh7b	UTSW	2	155626394	nonsense	probably null
R4794:Myh7b	UTSW	2	155623266	missense	probably benign	0.00
R4842:Myh7b	UTSW	2	155633989	missense	probably benign	0.45
R4871:Myh7b	UTSW	2	155613500	missense	probably benign	0.18
R5022:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5023:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5025:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5050:Myh7b	UTSW	2	155631750	missense	probably benign	0.00
R5055:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5056:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5161:Myh7b	UTSW	2	155632373	missense	possibly damaging	0.75
R5284:Myh7b	UTSW	2	155632314	missense	probably benign
R5422:Myh7b	UTSW	2	155631034	missense	probably damaging	0.99
R5505:Myh7b	UTSW	2	155632672	missense	probably benign	0.01
R5946:Myh7b	UTSW	2	155621395	missense	probably damaging	1.00
R6089:Myh7b	UTSW	2	155622489	missense	probably damaging	1.00
R6103:Myh7b	UTSW	2	155618743	missense	probably damaging	1.00
R6233:Myh7b	UTSW	2	155631799	missense	possibly damaging	0.85
R6292:Myh7b	UTSW	2	155632396	missense	probably damaging	1.00
R6350:Myh7b	UTSW	2	155628760	missense	probably benign	0.00
R6484:Myh7b	UTSW	2	155628643	missense	probably benign	0.05
R6760:Myh7b	UTSW	2	155620118	nonsense	probably null
R6896:Myh7b	UTSW	2	155622568	critical splice donor site	probably null
R6945:Myh7b	UTSW	2	155622232	missense	possibly damaging	0.95
R7052:Myh7b	UTSW	2	155614133	missense	probably damaging	1.00
R7102:Myh7b	UTSW	2	155622199	missense	probably damaging	1.00
R7248:Myh7b	UTSW	2	155622186	missense	probably damaging	1.00
R7303:Myh7b	UTSW	2	155618740	missense	probably damaging	1.00
R7360:Myh7b	UTSW	2	155632540	missense	probably benign	0.38
R7652:Myh7b	UTSW	2	155632236	missense	probably damaging	0.99
R7678:Myh7b	UTSW	2	155617778	splice site	probably null
R7703:Myh7b	UTSW	2	155620436	missense	probably null	1.00
R7711:Myh7b	UTSW	2	155620403	missense	probably damaging	1.00
R7923:Myh7b	UTSW	2	155625966	missense	probably benign
R7967:Myh7b	UTSW	2	155614199	splice site	probably null
R8045:Myh7b	UTSW	2	155613181	missense	probably benign	0.00
R8176:Myh7b	UTSW	2	155625966	missense	probably benign	0.06
R8272:Myh7b	UTSW	2	155632904	missense	probably damaging	1.00
R8560:Myh7b	UTSW	2	155623204	missense	possibly damaging	0.93
R8706:Myh7b	UTSW	2	155611749	critical splice donor site	probably null
R8824:Myh7b	UTSW	2	155630381	missense	probably benign	0.02
R8832:Myh7b	UTSW	2	155633262	missense	probably benign	0.00
R9079:Myh7b	UTSW	2	155623254	missense	probably damaging	0.97
R9151:Myh7b	UTSW	2	155632519	missense	probably damaging	1.00
R9311:Myh7b	UTSW	2	155621333	missense	probably damaging	1.00
R9332:Myh7b	UTSW	2	155628802	missense	probably damaging	1.00
R9357:Myh7b	UTSW	2	155621348	missense	probably damaging	1.00
R9388:Myh7b	UTSW	2	155631063	missense	probably benign	0.28
X0013:Myh7b	UTSW	2	155631169	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGATCAGTGACCTTACAGACCAG -3'
(R):5'- ACCACCTCTGGAATGGGAAC -3'

Sequencing Primer
(F):5'- TTACAGACCAGGTCAGCCTCAG -3'
(R):5'- AACACTCTAGTCCTGTGGCAG -3'

Posted On

2019-05-13