Incidental Mutation 'R7020:Zfp639'
ID545561
Institutional Source Beutler Lab
Gene Symbol Zfp639
Ensembl Gene ENSMUSG00000027667
Gene Namezinc finger protein 639
Synonyms6230400O18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R7020 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location32510259-32520833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 32520112 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 295 (D295E)
Ref Sequence ENSEMBL: ENSMUSP00000141341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029203] [ENSMUST00000191783] [ENSMUST00000192985] [ENSMUST00000193119] [ENSMUST00000193287]
Predicted Effect probably damaging
Transcript: ENSMUST00000029203
AA Change: D295E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029203
Gene: ENSMUSG00000027667
AA Change: D295E

DomainStartEndE-ValueType
ZnF_C2H2 204 227 2.49e-1 SMART
ZnF_C2H2 233 255 8.09e-1 SMART
ZnF_C2H2 260 283 1.16e-1 SMART
ZnF_C2H2 289 311 2.14e0 SMART
ZnF_C2H2 317 340 3.47e0 SMART
ZnF_C2H2 374 397 3.29e-1 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 454 2.86e-1 SMART
ZnF_C2H2 460 482 1.67e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191783
AA Change: D295E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141446
Gene: ENSMUSG00000027667
AA Change: D295E

DomainStartEndE-ValueType
ZnF_C2H2 204 227 2.49e-1 SMART
ZnF_C2H2 233 255 8.09e-1 SMART
ZnF_C2H2 260 283 1.16e-1 SMART
ZnF_C2H2 289 311 2.14e0 SMART
ZnF_C2H2 317 340 3.47e0 SMART
ZnF_C2H2 374 397 3.29e-1 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 454 2.86e-1 SMART
ZnF_C2H2 460 482 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192985
Predicted Effect probably benign
Transcript: ENSMUST00000193119
Predicted Effect probably damaging
Transcript: ENSMUST00000193287
AA Change: D295E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141341
Gene: ENSMUSG00000027667
AA Change: D295E

DomainStartEndE-ValueType
ZnF_C2H2 204 227 2.49e-1 SMART
ZnF_C2H2 233 255 8.09e-1 SMART
ZnF_C2H2 260 283 1.16e-1 SMART
ZnF_C2H2 289 311 2.14e0 SMART
ZnF_C2H2 317 340 3.47e0 SMART
ZnF_C2H2 374 397 3.29e-1 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 454 2.86e-1 SMART
ZnF_C2H2 460 482 1.67e-2 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel-like zinc finger family of proteins. Amplification and overexpression of this gene have been observed in esophageal squamous cell carcinoma. The encoded protein has been shown to bind DNA in a sequence-specific manner and may regulate HIV-1 gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,668,541 G188R probably damaging Het
Abhd3 T C 18: 10,645,127 Y384C probably damaging Het
Cd209b T A 8: 3,918,783 E282V probably damaging Het
Cep350 A C 1: 155,928,331 L1002W probably damaging Het
Clcn1 T C 6: 42,298,820 V292A probably damaging Het
Clcn7 T C 17: 25,146,351 I107T possibly damaging Het
Cntrob A G 11: 69,303,092 probably null Het
Crb1 A T 1: 139,231,603 S1294T possibly damaging Het
Cst13 T G 2: 148,823,209 Y41* probably null Het
Gp1ba A G 11: 70,640,313 probably benign Het
Gucy2e A T 11: 69,232,793 L427I probably benign Het
Gucy2g A G 19: 55,233,050 S340P probably damaging Het
Herc1 A G 9: 66,486,078 T4080A probably benign Het
Iglon5 A T 7: 43,476,895 C195S probably damaging Het
Itgae A G 11: 73,111,369 T100A probably damaging Het
Jarid2 C T 13: 44,884,824 S205L probably damaging Het
Macrod2 A T 2: 142,389,875 *424C probably null Het
Map2k6 A T 11: 110,506,714 probably benign Het
Muc4 A T 16: 32,751,810 K563* probably null Het
Myh7b T C 2: 155,631,751 I1568T possibly damaging Het
Myo15b G A 11: 115,866,667 W1114* probably null Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Notch1 T C 2: 26,481,574 T288A possibly damaging Het
Npc1 C T 18: 12,198,537 G859R probably damaging Het
Olfm2 T A 9: 20,668,568 R326W probably damaging Het
Olfr1000 A G 2: 85,608,632 S93P probably benign Het
Olfr1043 A G 2: 86,162,019 I310T probably benign Het
Olfr13 T C 6: 43,174,162 Y59H possibly damaging Het
Ovol1 G A 19: 5,560,233 P23L probably damaging Het
Pappa2 C A 1: 158,848,009 V1056F probably damaging Het
Pik3ca T C 3: 32,436,279 L25S probably damaging Het
Pla2r1 T C 2: 60,447,399 H860R possibly damaging Het
Pms1 A T 1: 53,189,382 H902Q probably damaging Het
Ptgs1 T G 2: 36,251,029 L496R probably damaging Het
Ralgapa2 A T 2: 146,346,718 Y1381* probably null Het
Rtl1 T C 12: 109,592,315 Q1030R possibly damaging Het
Ryr3 T A 2: 112,753,078 Y2816F probably benign Het
Sh2b2 T C 5: 136,224,299 T340A possibly damaging Het
Slc30a5 T A 13: 100,824,913 probably null Het
Spta1 T C 1: 174,209,352 L1143P probably damaging Het
St8sia5 T C 18: 77,246,180 I178T probably damaging Het
Tap2 A G 17: 34,214,414 N517S possibly damaging Het
Tcp11 A G 17: 28,071,705 Y227H possibly damaging Het
Usp34 A G 11: 23,393,954 D1411G probably benign Het
Vmn2r105 A G 17: 20,209,074 L580P probably damaging Het
Wdr19 A G 5: 65,256,314 E1200G probably damaging Het
Xirp2 T C 2: 67,525,569 V3558A probably benign Het
Xpo7 T C 14: 70,666,023 N1082S probably benign Het
Zbtb49 A T 5: 38,213,367 L390* probably null Het
Other mutations in Zfp639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Zfp639 APN 3 32519753 splice site probably null
IGL00571:Zfp639 APN 3 32519919 missense probably damaging 0.99
IGL00579:Zfp639 APN 3 32520477 missense probably damaging 0.98
IGL01952:Zfp639 APN 3 32515347 missense probably damaging 1.00
PIT4514001:Zfp639 UTSW 3 32520260 missense possibly damaging 0.46
R0412:Zfp639 UTSW 3 32517110 missense possibly damaging 0.92
R1195:Zfp639 UTSW 3 32519196 missense possibly damaging 0.92
R1195:Zfp639 UTSW 3 32519196 missense possibly damaging 0.92
R1195:Zfp639 UTSW 3 32519196 missense possibly damaging 0.92
R2906:Zfp639 UTSW 3 32519751 missense probably damaging 0.99
R4660:Zfp639 UTSW 3 32520530 missense probably damaging 0.99
R5109:Zfp639 UTSW 3 32520436 splice site probably null
R6012:Zfp639 UTSW 3 32519122 missense probably damaging 1.00
R6321:Zfp639 UTSW 3 32517088 missense probably damaging 1.00
R6449:Zfp639 UTSW 3 32519661 missense possibly damaging 0.92
R8034:Zfp639 UTSW 3 32520066 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGACTCGAATGTGTGTCGG -3'
(R):5'- TGCTTAAAAGGCTGCACTGC -3'

Sequencing Primer
(F):5'- GGTGTGTAAGGAAAGCTTCTCTACC -3'
(R):5'- ATGGCCACCACTGCCAC -3'
Posted On2019-05-13