Incidental Mutation 'R7020:Sh2b2'
ID545564
Institutional Source Beutler Lab
Gene Symbol Sh2b2
Ensembl Gene ENSMUSG00000005057
Gene NameSH2B adaptor protein 2
SynonymsAps
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R7020 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location136218147-136246556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136224299 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 340 (T340A)
Ref Sequence ENSEMBL: ENSMUSP00000142728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005188] [ENSMUST00000196397] [ENSMUST00000196447]
Predicted Effect probably benign
Transcript: ENSMUST00000005188
AA Change: T340A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000005188
Gene: ENSMUSG00000005057
AA Change: T340A

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
Pfam:Phe_ZIP 17 73 9.3e-22 PFAM
Blast:PH 95 168 2e-21 BLAST
low complexity region 169 180 N/A INTRINSIC
PH 187 301 4.97e-9 SMART
low complexity region 340 350 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
SH2 407 492 1.38e-21 SMART
low complexity region 509 525 N/A INTRINSIC
low complexity region 548 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196397
AA Change: T340A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000142398
Gene: ENSMUSG00000005057
AA Change: T340A

DomainStartEndE-ValueType
Pfam:Phe_ZIP 16 74 1.5e-30 PFAM
Blast:PH 95 168 2e-21 BLAST
low complexity region 169 180 N/A INTRINSIC
PH 187 301 4.97e-9 SMART
low complexity region 340 350 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
SH2 407 492 1.38e-21 SMART
low complexity region 509 525 N/A INTRINSIC
low complexity region 548 576 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196447
AA Change: T340A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142728
Gene: ENSMUSG00000005057
AA Change: T340A

DomainStartEndE-ValueType
Pfam:Phe_ZIP 16 74 9.1e-28 PFAM
Blast:PH 95 168 9e-22 BLAST
low complexity region 169 180 N/A INTRINSIC
PH 187 301 2.2e-11 SMART
low complexity region 340 350 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in B lymphocytes and contains pleckstrin homology and src homology 2 (SH2) domains. In Burkitt's lymphoma cell lines, it is tyrosine-phosphorylated in response to B cell receptor stimulation. Because it binds Shc independent of stimulation and Grb2 after stimulation, it appears to play a role in signal transduction from the receptor to the Shc/Grb2 pathway. [provided by RefSeq, Jun 2009]
PHENOTYPE: Inactivation of this gene results in increased insulin sensitivity accompanied by hypoinsulinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,668,541 G188R probably damaging Het
Abhd3 T C 18: 10,645,127 Y384C probably damaging Het
Cd209b T A 8: 3,918,783 E282V probably damaging Het
Cep350 A C 1: 155,928,331 L1002W probably damaging Het
Clcn1 T C 6: 42,298,820 V292A probably damaging Het
Clcn7 T C 17: 25,146,351 I107T possibly damaging Het
Cntrob A G 11: 69,303,092 probably null Het
Crb1 A T 1: 139,231,603 S1294T possibly damaging Het
Cst13 T G 2: 148,823,209 Y41* probably null Het
Gp1ba A G 11: 70,640,313 probably benign Het
Gucy2e A T 11: 69,232,793 L427I probably benign Het
Gucy2g A G 19: 55,233,050 S340P probably damaging Het
Herc1 A G 9: 66,486,078 T4080A probably benign Het
Iglon5 A T 7: 43,476,895 C195S probably damaging Het
Itgae A G 11: 73,111,369 T100A probably damaging Het
Jarid2 C T 13: 44,884,824 S205L probably damaging Het
Macrod2 A T 2: 142,389,875 *424C probably null Het
Map2k6 A T 11: 110,506,714 probably benign Het
Muc4 A T 16: 32,751,810 K563* probably null Het
Myh7b T C 2: 155,631,751 I1568T possibly damaging Het
Myo15b G A 11: 115,866,667 W1114* probably null Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Notch1 T C 2: 26,481,574 T288A possibly damaging Het
Npc1 C T 18: 12,198,537 G859R probably damaging Het
Olfm2 T A 9: 20,668,568 R326W probably damaging Het
Olfr1000 A G 2: 85,608,632 S93P probably benign Het
Olfr1043 A G 2: 86,162,019 I310T probably benign Het
Olfr13 T C 6: 43,174,162 Y59H possibly damaging Het
Ovol1 G A 19: 5,560,233 P23L probably damaging Het
Pappa2 C A 1: 158,848,009 V1056F probably damaging Het
Pik3ca T C 3: 32,436,279 L25S probably damaging Het
Pla2r1 T C 2: 60,447,399 H860R possibly damaging Het
Pms1 A T 1: 53,189,382 H902Q probably damaging Het
Ptgs1 T G 2: 36,251,029 L496R probably damaging Het
Ralgapa2 A T 2: 146,346,718 Y1381* probably null Het
Rtl1 T C 12: 109,592,315 Q1030R possibly damaging Het
Ryr3 T A 2: 112,753,078 Y2816F probably benign Het
Slc30a5 T A 13: 100,824,913 probably null Het
Spta1 T C 1: 174,209,352 L1143P probably damaging Het
St8sia5 T C 18: 77,246,180 I178T probably damaging Het
Tap2 A G 17: 34,214,414 N517S possibly damaging Het
Tcp11 A G 17: 28,071,705 Y227H possibly damaging Het
Usp34 A G 11: 23,393,954 D1411G probably benign Het
Vmn2r105 A G 17: 20,209,074 L580P probably damaging Het
Wdr19 A G 5: 65,256,314 E1200G probably damaging Het
Xirp2 T C 2: 67,525,569 V3558A probably benign Het
Xpo7 T C 14: 70,666,023 N1082S probably benign Het
Zbtb49 A T 5: 38,213,367 L390* probably null Het
Zfp639 C A 3: 32,520,112 D295E probably damaging Het
Other mutations in Sh2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Sh2b2 APN 5 136224419 missense probably damaging 1.00
IGL01456:Sh2b2 APN 5 136224467 missense probably damaging 0.98
IGL01612:Sh2b2 APN 5 136231802 missense probably benign 0.02
IGL02798:Sh2b2 APN 5 136221963 missense probably damaging 1.00
R0492:Sh2b2 UTSW 5 136232263 missense probably damaging 1.00
R0539:Sh2b2 UTSW 5 136225301 splice site probably benign
R0707:Sh2b2 UTSW 5 136232263 missense probably damaging 1.00
R1569:Sh2b2 UTSW 5 136231735 missense possibly damaging 0.89
R1777:Sh2b2 UTSW 5 136227422 missense probably damaging 1.00
R2088:Sh2b2 UTSW 5 136232114 missense possibly damaging 0.87
R3702:Sh2b2 UTSW 5 136224233 missense probably damaging 0.99
R4223:Sh2b2 UTSW 5 136219053 missense possibly damaging 0.91
R4597:Sh2b2 UTSW 5 136231762 missense probably damaging 0.99
R4683:Sh2b2 UTSW 5 136231720 missense probably damaging 1.00
R4766:Sh2b2 UTSW 5 136231957 missense probably damaging 0.99
R5486:Sh2b2 UTSW 5 136232090 missense probably benign 0.10
R6060:Sh2b2 UTSW 5 136232355 missense possibly damaging 0.72
R6322:Sh2b2 UTSW 5 136224188 missense probably damaging 0.99
R7034:Sh2b2 UTSW 5 136218885 missense probably benign 0.18
R7036:Sh2b2 UTSW 5 136218885 missense probably benign 0.18
R7615:Sh2b2 UTSW 5 136219657 missense probably damaging 1.00
R7715:Sh2b2 UTSW 5 136219035 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACATGGGTCCCTGTAGAAGG -3'
(R):5'- ATGCTGCGTCTTCTCCACAG -3'

Sequencing Primer
(F):5'- CCTGTAGAAGGGGGTGGG -3'
(R):5'- ACAGGACTGTCTTGTGCAC -3'
Posted On2019-05-13