Incidental Mutation 'R7020:1700001K19Rik'
ID545581
Institutional Source Beutler Lab
Gene Symbol 1700001K19Rik
Ensembl Gene ENSMUSG00000056508
Gene NameRIKEN cDNA 1700001K19 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7020 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location110667688-110682619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110668541 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 188 (G188R)
Ref Sequence ENSEMBL: ENSMUSP00000068238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018851] [ENSMUST00000070659] [ENSMUST00000222915]
Predicted Effect probably benign
Transcript: ENSMUST00000018851
SMART Domains Protein: ENSMUSP00000018851
Gene: ENSMUSG00000018707

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
Pfam:DHC_N1 237 830 1.9e-145 PFAM
coiled coil region 1171 1198 N/A INTRINSIC
Pfam:DHC_N2 1317 1721 3.3e-116 PFAM
AAA 1899 2043 5.39e-2 SMART
low complexity region 2102 2116 N/A INTRINSIC
AAA 2214 2365 2.13e0 SMART
low complexity region 2394 2405 N/A INTRINSIC
AAA 2585 2735 8.6e-7 SMART
Blast:AAA 2777 2811 2e-13 BLAST
AAA 2927 3093 4.79e-5 SMART
Pfam:MT 3197 3534 1.1e-44 PFAM
Pfam:AAA_9 3554 3778 8.5e-75 PFAM
Pfam:Dynein_heavy 3919 4642 4.3e-163 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070659
AA Change: G188R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068238
Gene: ENSMUSG00000056508
AA Change: G188R

DomainStartEndE-ValueType
low complexity region 196 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222915
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T C 18: 10,645,127 Y384C probably damaging Het
Cd209b T A 8: 3,918,783 E282V probably damaging Het
Cep350 A C 1: 155,928,331 L1002W probably damaging Het
Clcn1 T C 6: 42,298,820 V292A probably damaging Het
Clcn7 T C 17: 25,146,351 I107T possibly damaging Het
Cntrob A G 11: 69,303,092 probably null Het
Crb1 A T 1: 139,231,603 S1294T possibly damaging Het
Cst13 T G 2: 148,823,209 Y41* probably null Het
Gp1ba A G 11: 70,640,313 probably benign Het
Gucy2e A T 11: 69,232,793 L427I probably benign Het
Gucy2g A G 19: 55,233,050 S340P probably damaging Het
Herc1 A G 9: 66,486,078 T4080A probably benign Het
Iglon5 A T 7: 43,476,895 C195S probably damaging Het
Itgae A G 11: 73,111,369 T100A probably damaging Het
Jarid2 C T 13: 44,884,824 S205L probably damaging Het
Macrod2 A T 2: 142,389,875 *424C probably null Het
Map2k6 A T 11: 110,506,714 probably benign Het
Muc4 A T 16: 32,751,810 K563* probably null Het
Myh7b T C 2: 155,631,751 I1568T possibly damaging Het
Myo15b G A 11: 115,866,667 W1114* probably null Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Notch1 T C 2: 26,481,574 T288A possibly damaging Het
Npc1 C T 18: 12,198,537 G859R probably damaging Het
Olfm2 T A 9: 20,668,568 R326W probably damaging Het
Olfr1000 A G 2: 85,608,632 S93P probably benign Het
Olfr1043 A G 2: 86,162,019 I310T probably benign Het
Olfr13 T C 6: 43,174,162 Y59H possibly damaging Het
Ovol1 G A 19: 5,560,233 P23L probably damaging Het
Pappa2 C A 1: 158,848,009 V1056F probably damaging Het
Pik3ca T C 3: 32,436,279 L25S probably damaging Het
Pla2r1 T C 2: 60,447,399 H860R possibly damaging Het
Pms1 A T 1: 53,189,382 H902Q probably damaging Het
Ptgs1 T G 2: 36,251,029 L496R probably damaging Het
Ralgapa2 A T 2: 146,346,718 Y1381* probably null Het
Rtl1 T C 12: 109,592,315 Q1030R possibly damaging Het
Ryr3 T A 2: 112,753,078 Y2816F probably benign Het
Sh2b2 T C 5: 136,224,299 T340A possibly damaging Het
Slc30a5 T A 13: 100,824,913 probably null Het
Spta1 T C 1: 174,209,352 L1143P probably damaging Het
St8sia5 T C 18: 77,246,180 I178T probably damaging Het
Tap2 A G 17: 34,214,414 N517S possibly damaging Het
Tcp11 A G 17: 28,071,705 Y227H possibly damaging Het
Usp34 A G 11: 23,393,954 D1411G probably benign Het
Vmn2r105 A G 17: 20,209,074 L580P probably damaging Het
Wdr19 A G 5: 65,256,314 E1200G probably damaging Het
Xirp2 T C 2: 67,525,569 V3558A probably benign Het
Xpo7 T C 14: 70,666,023 N1082S probably benign Het
Zbtb49 A T 5: 38,213,367 L390* probably null Het
Zfp639 C A 3: 32,520,112 D295E probably damaging Het
Other mutations in 1700001K19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:1700001K19Rik UTSW 12 110668449 unclassified probably benign
FR4304:1700001K19Rik UTSW 12 110668450 unclassified probably benign
FR4548:1700001K19Rik UTSW 12 110668449 unclassified probably benign
FR4548:1700001K19Rik UTSW 12 110668452 unclassified probably benign
FR4737:1700001K19Rik UTSW 12 110668448 unclassified probably benign
FR4976:1700001K19Rik UTSW 12 110668447 unclassified probably benign
FR4976:1700001K19Rik UTSW 12 110668450 unclassified probably benign
R0266:1700001K19Rik UTSW 12 110668754 missense possibly damaging 0.59
R1345:1700001K19Rik UTSW 12 110668718 missense probably damaging 1.00
R1859:1700001K19Rik UTSW 12 110670834 start gained probably benign
R7225:1700001K19Rik UTSW 12 110670865 splice site probably benign
R7311:1700001K19Rik UTSW 12 110668750 missense probably benign
RF022:1700001K19Rik UTSW 12 110668443 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTAAGGACTGAGTTTGGCGT -3'
(R):5'- GAAAGCTTCTGTCTGGGCCC -3'

Sequencing Primer
(F):5'- ACTGAGTTTGGCGTGGGTCC -3'
(R):5'- AGTCCATGACGTCGACATG -3'
Posted On2019-05-13