Incidental Mutation 'R7020:Tcp11'
ID545587
Institutional Source Beutler Lab
Gene Symbol Tcp11
Ensembl Gene ENSMUSG00000062859
Gene Namet-complex protein 11
SynonymsD17Ken1, Tcp-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7020 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location28066747-28080639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28071705 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 227 (Y227H)
Ref Sequence ENSEMBL: ENSMUSP00000038590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042692] [ENSMUST00000043925] [ENSMUST00000114836] [ENSMUST00000129046] [ENSMUST00000141806]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042692
AA Change: Y227H

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038590
Gene: ENSMUSG00000062859
AA Change: Y227H

DomainStartEndE-ValueType
Pfam:Tcp11 126 550 6.2e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043925
AA Change: Y148H

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046002
Gene: ENSMUSG00000062859
AA Change: Y148H

DomainStartEndE-ValueType
Pfam:Tcp11 44 474 3.3e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114836
AA Change: Y148H

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110485
Gene: ENSMUSG00000062859
AA Change: Y148H

DomainStartEndE-ValueType
Pfam:Tcp11 44 474 3.3e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129046
AA Change: Y148H

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116959
Gene: ENSMUSG00000062859
AA Change: Y148H

DomainStartEndE-ValueType
Pfam:Tcp11 44 237 2.5e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141806
SMART Domains Protein: ENSMUSP00000122010
Gene: ENSMUSG00000062859

DomainStartEndE-ValueType
Pfam:Tcp11 123 183 7.1e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,668,541 G188R probably damaging Het
Abhd3 T C 18: 10,645,127 Y384C probably damaging Het
Cd209b T A 8: 3,918,783 E282V probably damaging Het
Cep350 A C 1: 155,928,331 L1002W probably damaging Het
Clcn1 T C 6: 42,298,820 V292A probably damaging Het
Clcn7 T C 17: 25,146,351 I107T possibly damaging Het
Cntrob A G 11: 69,303,092 probably null Het
Crb1 A T 1: 139,231,603 S1294T possibly damaging Het
Cst13 T G 2: 148,823,209 Y41* probably null Het
Gp1ba A G 11: 70,640,313 probably benign Het
Gucy2e A T 11: 69,232,793 L427I probably benign Het
Gucy2g A G 19: 55,233,050 S340P probably damaging Het
Herc1 A G 9: 66,486,078 T4080A probably benign Het
Iglon5 A T 7: 43,476,895 C195S probably damaging Het
Itgae A G 11: 73,111,369 T100A probably damaging Het
Jarid2 C T 13: 44,884,824 S205L probably damaging Het
Macrod2 A T 2: 142,389,875 *424C probably null Het
Map2k6 A T 11: 110,506,714 probably benign Het
Muc4 A T 16: 32,751,810 K563* probably null Het
Myh7b T C 2: 155,631,751 I1568T possibly damaging Het
Myo15b G A 11: 115,866,667 W1114* probably null Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Notch1 T C 2: 26,481,574 T288A possibly damaging Het
Npc1 C T 18: 12,198,537 G859R probably damaging Het
Olfm2 T A 9: 20,668,568 R326W probably damaging Het
Olfr1000 A G 2: 85,608,632 S93P probably benign Het
Olfr1043 A G 2: 86,162,019 I310T probably benign Het
Olfr13 T C 6: 43,174,162 Y59H possibly damaging Het
Ovol1 G A 19: 5,560,233 P23L probably damaging Het
Pappa2 C A 1: 158,848,009 V1056F probably damaging Het
Pik3ca T C 3: 32,436,279 L25S probably damaging Het
Pla2r1 T C 2: 60,447,399 H860R possibly damaging Het
Pms1 A T 1: 53,189,382 H902Q probably damaging Het
Ptgs1 T G 2: 36,251,029 L496R probably damaging Het
Ralgapa2 A T 2: 146,346,718 Y1381* probably null Het
Rtl1 T C 12: 109,592,315 Q1030R possibly damaging Het
Ryr3 T A 2: 112,753,078 Y2816F probably benign Het
Sh2b2 T C 5: 136,224,299 T340A possibly damaging Het
Slc30a5 T A 13: 100,824,913 probably null Het
Spta1 T C 1: 174,209,352 L1143P probably damaging Het
St8sia5 T C 18: 77,246,180 I178T probably damaging Het
Tap2 A G 17: 34,214,414 N517S possibly damaging Het
Usp34 A G 11: 23,393,954 D1411G probably benign Het
Vmn2r105 A G 17: 20,209,074 L580P probably damaging Het
Wdr19 A G 5: 65,256,314 E1200G probably damaging Het
Xirp2 T C 2: 67,525,569 V3558A probably benign Het
Xpo7 T C 14: 70,666,023 N1082S probably benign Het
Zbtb49 A T 5: 38,213,367 L390* probably null Het
Zfp639 C A 3: 32,520,112 D295E probably damaging Het
Other mutations in Tcp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02993:Tcp11 APN 17 28070516 missense probably damaging 1.00
IGL03148:Tcp11 APN 17 28070470 missense possibly damaging 0.95
R0487:Tcp11 UTSW 17 28079923 splice site probably null
R0603:Tcp11 UTSW 17 28067810 missense probably damaging 1.00
R0745:Tcp11 UTSW 17 28067160 missense possibly damaging 0.80
R1170:Tcp11 UTSW 17 28071662 missense probably damaging 1.00
R2965:Tcp11 UTSW 17 28069265 missense probably benign 0.38
R5249:Tcp11 UTSW 17 28071783 missense possibly damaging 0.71
R5358:Tcp11 UTSW 17 28078020 missense probably benign 0.05
R5819:Tcp11 UTSW 17 28069236 missense probably damaging 1.00
R6190:Tcp11 UTSW 17 28071717 missense probably benign 0.00
R6657:Tcp11 UTSW 17 28071672 missense probably damaging 1.00
R6698:Tcp11 UTSW 17 28071830 missense possibly damaging 0.63
R7084:Tcp11 UTSW 17 28067021 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TGTAAGAACCAACAGGCCAG -3'
(R):5'- GCAAAGGATTGAACCCTGGG -3'

Sequencing Primer
(F):5'- AGACTGTGGAGACAATGTCTG -3'
(R):5'- CCCTGGGGTAATGTAGGACAG -3'
Posted On2019-05-13