Incidental Mutation 'R7020:St8sia5'
ID545591
Institutional Source Beutler Lab
Gene Symbol St8sia5
Ensembl Gene ENSMUSG00000025425
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
SynonymsSiat8e, ST8SiaV
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7020 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location77185853-77255450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77246180 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 178 (I178T)
Ref Sequence ENSEMBL: ENSMUSP00000074764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075290] [ENSMUST00000079618]
Predicted Effect probably damaging
Transcript: ENSMUST00000075290
AA Change: I178T

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074764
Gene: ENSMUSG00000025425
AA Change: I178T

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 152 407 6.4e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000079618
AA Change: I142T

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078566
Gene: ENSMUSG00000025425
AA Change: I142T

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 112 372 5.4e-79 PFAM
Meta Mutation Damage Score 0.5646 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that may be present in the Golgi apparatus. The encoded protein, which is a member of glycosyltransferase family 29, may be involved in the synthesis of gangliosides GD1c, GT1a, GQ1b, and GT3 from GD1a, GT1b, GM1b, and GD3, respectively. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik C T 12: 110,668,541 G188R probably damaging Het
Abhd3 T C 18: 10,645,127 Y384C probably damaging Het
Cd209b T A 8: 3,918,783 E282V probably damaging Het
Cep350 A C 1: 155,928,331 L1002W probably damaging Het
Clcn1 T C 6: 42,298,820 V292A probably damaging Het
Clcn7 T C 17: 25,146,351 I107T possibly damaging Het
Cntrob A G 11: 69,303,092 probably null Het
Crb1 A T 1: 139,231,603 S1294T possibly damaging Het
Cst13 T G 2: 148,823,209 Y41* probably null Het
Gp1ba A G 11: 70,640,313 probably benign Het
Gucy2e A T 11: 69,232,793 L427I probably benign Het
Gucy2g A G 19: 55,233,050 S340P probably damaging Het
Herc1 A G 9: 66,486,078 T4080A probably benign Het
Iglon5 A T 7: 43,476,895 C195S probably damaging Het
Itgae A G 11: 73,111,369 T100A probably damaging Het
Jarid2 C T 13: 44,884,824 S205L probably damaging Het
Macrod2 A T 2: 142,389,875 *424C probably null Het
Map2k6 A T 11: 110,506,714 probably benign Het
Muc4 A T 16: 32,751,810 K563* probably null Het
Myh7b T C 2: 155,631,751 I1568T possibly damaging Het
Myo15b G A 11: 115,866,667 W1114* probably null Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Notch1 T C 2: 26,481,574 T288A possibly damaging Het
Npc1 C T 18: 12,198,537 G859R probably damaging Het
Olfm2 T A 9: 20,668,568 R326W probably damaging Het
Olfr1000 A G 2: 85,608,632 S93P probably benign Het
Olfr1043 A G 2: 86,162,019 I310T probably benign Het
Olfr13 T C 6: 43,174,162 Y59H possibly damaging Het
Ovol1 G A 19: 5,560,233 P23L probably damaging Het
Pappa2 C A 1: 158,848,009 V1056F probably damaging Het
Pik3ca T C 3: 32,436,279 L25S probably damaging Het
Pla2r1 T C 2: 60,447,399 H860R possibly damaging Het
Pms1 A T 1: 53,189,382 H902Q probably damaging Het
Ptgs1 T G 2: 36,251,029 L496R probably damaging Het
Ralgapa2 A T 2: 146,346,718 Y1381* probably null Het
Rtl1 T C 12: 109,592,315 Q1030R possibly damaging Het
Ryr3 T A 2: 112,753,078 Y2816F probably benign Het
Sh2b2 T C 5: 136,224,299 T340A possibly damaging Het
Slc30a5 T A 13: 100,824,913 probably null Het
Spta1 T C 1: 174,209,352 L1143P probably damaging Het
Tap2 A G 17: 34,214,414 N517S possibly damaging Het
Tcp11 A G 17: 28,071,705 Y227H possibly damaging Het
Usp34 A G 11: 23,393,954 D1411G probably benign Het
Vmn2r105 A G 17: 20,209,074 L580P probably damaging Het
Wdr19 A G 5: 65,256,314 E1200G probably damaging Het
Xirp2 T C 2: 67,525,569 V3558A probably benign Het
Xpo7 T C 14: 70,666,023 N1082S probably benign Het
Zbtb49 A T 5: 38,213,367 L390* probably null Het
Zfp639 C A 3: 32,520,112 D295E probably damaging Het
Other mutations in St8sia5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:St8sia5 APN 18 77254662 missense probably damaging 1.00
IGL01320:St8sia5 APN 18 77254622 missense probably damaging 1.00
IGL01682:St8sia5 APN 18 77248500 missense probably damaging 0.99
IGL01984:St8sia5 APN 18 77248461 missense probably benign 0.03
ANU22:St8sia5 UTSW 18 77254662 missense probably damaging 1.00
R0194:St8sia5 UTSW 18 77254724 missense probably benign 0.13
R0392:St8sia5 UTSW 18 77254406 missense probably damaging 1.00
R0622:St8sia5 UTSW 18 77246113 missense probably damaging 1.00
R0696:St8sia5 UTSW 18 77254464 missense probably damaging 1.00
R1231:St8sia5 UTSW 18 77232806 missense probably damaging 0.97
R1559:St8sia5 UTSW 18 77211764 critical splice donor site probably null
R2058:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2059:St8sia5 UTSW 18 77254763 missense probably damaging 1.00
R2268:St8sia5 UTSW 18 77232830 missense probably damaging 0.99
R4399:St8sia5 UTSW 18 77253018 missense probably damaging 1.00
R4926:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R5986:St8sia5 UTSW 18 77254782 missense possibly damaging 0.84
R6301:St8sia5 UTSW 18 77246140 missense probably damaging 0.98
R7087:St8sia5 UTSW 18 77254542 missense possibly damaging 0.88
R7784:St8sia5 UTSW 18 77254550 missense probably benign 0.36
R8037:St8sia5 UTSW 18 77248542 missense possibly damaging 0.95
R8153:St8sia5 UTSW 18 77253111 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGGCAGGCAGAGAGTTTCC -3'
(R):5'- AGCTAGATGGTATTGTCACCCC -3'

Sequencing Primer
(F):5'- CAGGCAGAGAGTTTCCCAGTAG -3'
(R):5'- AGGCAGGACTCCTCTGGAAG -3'
Posted On2019-05-13