Incidental Mutation 'R7021:Bicc1'
ID545634
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene NameBicC family RNA binding protein 1
SynonymsBic-C, jcpk
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7021 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location70922832-71159700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70961148 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 127 (V127A)
Ref Sequence ENSEMBL: ENSMUSP00000123201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
Predicted Effect probably benign
Transcript: ENSMUST00000014473
AA Change: V127A

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: V127A

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131445
AA Change: V45A

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: V45A

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143791
AA Change: V127A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: V127A

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 C T 12: 118,931,925 V379I probably benign Het
Adamts15 T C 9: 30,921,480 Y253C probably damaging Het
Ahsa1 T C 12: 87,271,380 S37P possibly damaging Het
Arnt2 A T 7: 84,343,942 L130H probably damaging Het
Atp8b5 T A 4: 43,355,618 F533I probably damaging Het
Best1 A G 19: 9,986,779 V439A probably benign Het
Brd7 T C 8: 88,347,004 T253A probably benign Het
Btd A G 14: 31,667,831 D503G probably benign Het
Ccdc80 A G 16: 45,104,441 E646G probably damaging Het
Ccl25 A G 8: 4,349,641 probably benign Het
Ccnf C A 17: 24,242,231 W150L probably damaging Het
Cdk11b A T 4: 155,641,567 probably benign Het
Cfap73 T C 5: 120,630,084 E203G probably benign Het
Cmya5 T C 13: 93,093,555 E1675G possibly damaging Het
Copg1 T A 6: 87,894,105 Y268N possibly damaging Het
Csnk2a1 T A 2: 152,260,812 H126Q probably damaging Het
Ctbs G A 3: 146,454,948 G90D probably damaging Het
Ctnna2 T C 6: 77,636,905 Y221C probably damaging Het
Cypt12 C T 3: 17,948,471 R3C unknown Het
D630003M21Rik A T 2: 158,216,750 M410K possibly damaging Het
Dnah9 A T 11: 65,981,231 N2724K probably benign Het
Dok3 T C 13: 55,524,284 T194A probably benign Het
Edem3 T G 1: 151,755,672 S36A probably benign Het
Eed C T 7: 89,980,519 E3K possibly damaging Het
Efcab2 A G 1: 178,481,360 I143V probably benign Het
Ensa A T 3: 95,627,048 probably null Het
Galnt16 A T 12: 80,580,052 E219V probably damaging Het
Gfra3 C A 18: 34,690,880 R347L probably benign Het
Gm13178 A C 4: 144,715,492 L63R probably damaging Het
Gm2042 T A 12: 87,960,239 I442K probably damaging Het
Gpld1 A T 13: 24,984,708 D735V probably damaging Het
Hspg2 T C 4: 137,542,269 S2253P possibly damaging Het
Kit T C 5: 75,620,967 I352T probably benign Het
Klra6 A T 6: 130,018,858 V179E possibly damaging Het
Lctl T A 9: 64,132,793 probably null Het
Lman1 C A 18: 65,991,643 V342L probably benign Het
Lrrn2 T C 1: 132,938,784 L529P probably damaging Het
Mab21l2 A G 3: 86,547,486 I69T probably benign Het
Mapkapk5 G T 5: 121,527,211 A327E probably benign Het
Mex3b G T 7: 82,869,872 R465L possibly damaging Het
Mgat3 A G 15: 80,212,454 N494S probably damaging Het
Mgat4c A G 10: 102,388,428 R168G possibly damaging Het
Mkks A G 2: 136,876,087 probably null Het
Muc16 G T 9: 18,554,919 H7368N unknown Het
Muc16 T C 9: 18,550,831 probably null Het
Nbeal1 G A 1: 60,261,586 probably null Het
Notch2 T C 3: 98,135,446 S1376P probably benign Het
Obox5 A G 7: 15,757,756 probably null Het
Olfr16 T C 1: 172,956,927 I44T probably benign Het
Olfr765 A T 10: 129,047,030 I11N probably damaging Het
Pbrm1 A G 14: 31,067,816 I807V probably damaging Het
Pitrm1 T A 13: 6,578,557 V962E probably damaging Het
Pkd2l1 T C 19: 44,154,208 Q465R probably damaging Het
Pla1a A G 16: 38,400,882 I372T probably damaging Het
Prmt5 A C 14: 54,515,388 F122C probably damaging Het
Prrc2b T A 2: 32,221,486 S1905T probably damaging Het
Ptprf T G 4: 118,223,904 K1163N probably benign Het
Rab3ip A G 10: 116,939,378 V25A probably damaging Het
Raf1 T C 6: 115,620,339 probably null Het
Rnf180 T C 13: 105,270,921 E40G probably benign Het
Rpl6 T A 5: 121,208,909 M289K probably benign Het
Slc25a32 A G 15: 39,099,926 F167L probably benign Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Slc4a4 T A 5: 89,040,346 probably null Het
Sppl2a A G 2: 126,927,743 probably null Het
Tbr1 T A 2: 61,807,344 D82E probably benign Het
Tbx10 A T 19: 3,998,961 T291S probably benign Het
Tlr1 T A 5: 64,925,713 H507L possibly damaging Het
Trim37 A C 11: 87,167,509 T338P probably benign Het
Trpv5 T C 6: 41,653,270 T629A probably benign Het
Ttc14 T A 3: 33,803,497 I249N probably damaging Het
Uhrf1 A G 17: 56,320,450 T661A probably benign Het
Vmn2r65 A G 7: 84,947,379 I156T probably benign Het
Vwde T C 6: 13,186,906 N861D probably damaging Het
Zan A G 5: 137,423,951 C2802R unknown Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70943360 splice site probably benign
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
artemis UTSW 10 71027954 missense probably damaging 0.99
Pebbles UTSW 10 70947900 missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70957681 missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70961158 missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70925370 missense probably damaging 1.00
R0184:Bicc1 UTSW 10 71079215 missense probably benign
R0469:Bicc1 UTSW 10 71079215 missense probably benign
R0485:Bicc1 UTSW 10 70925315 missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70943518 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70950125 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70953484 missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70935831 critical splice donor site probably null
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70940522 missense probably benign 0.05
R5160:Bicc1 UTSW 10 70932236 missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70947900 missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70940520 missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70946969 missense probably benign 0.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
R6128:Bicc1 UTSW 10 70940483 splice site probably null
R6277:Bicc1 UTSW 10 71027901 missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70958922 missense probably damaging 1.00
R7101:Bicc1 UTSW 10 70930653 missense probably damaging 1.00
R7351:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7352:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7353:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7366:Bicc1 UTSW 10 70943386 missense probably benign 0.01
R7480:Bicc1 UTSW 10 70943476 missense probably damaging 1.00
R7541:Bicc1 UTSW 10 70946604 missense possibly damaging 0.82
R7544:Bicc1 UTSW 10 70956374 missense possibly damaging 0.89
R7555:Bicc1 UTSW 10 70956291 missense possibly damaging 0.75
R7663:Bicc1 UTSW 10 70946590 missense probably benign
R7671:Bicc1 UTSW 10 70957167 missense probably benign 0.01
R7747:Bicc1 UTSW 10 70946993 missense probably benign
RF013:Bicc1 UTSW 10 70935830 critical splice donor site probably null
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATGCTCACACTTGCGTG -3'
(R):5'- CGCATATACACAGTGCAGTAAC -3'

Sequencing Primer
(F):5'- CGTGTGTAAACGCGTTCATATAC -3'
(R):5'- CAGTGCAGTAACTACAGGGTTTATTG -3'
Posted On2019-05-13