Incidental Mutation 'R7021:Rab3ip'
ID545636
Institutional Source Beutler Lab
Gene Symbol Rab3ip
Ensembl Gene ENSMUSG00000064181
Gene NameRAB3A interacting protein
SynonymsRabin3, Gtpat12, SSX2 interacting protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7021 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location116905784-116950769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116939378 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 25 (V25A)
Ref Sequence ENSEMBL: ENSMUSP00000151708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020375] [ENSMUST00000218391] [ENSMUST00000219109] [ENSMUST00000219603]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020375
AA Change: V25A

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020375
Gene: ENSMUSG00000064181
AA Change: V25A

DomainStartEndE-ValueType
low complexity region 84 100 N/A INTRINSIC
PDB:4LHZ|F 157 200 9e-15 PDB
low complexity region 213 220 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000218391
AA Change: V25A

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000219109
AA Change: V25A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219603
AA Change: V25A

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (75/76)
MGI Phenotype PHENOTYPE: Homozygous null mice are fertile and show no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 C T 12: 118,931,925 V379I probably benign Het
Adamts15 T C 9: 30,921,480 Y253C probably damaging Het
Ahsa1 T C 12: 87,271,380 S37P possibly damaging Het
Arnt2 A T 7: 84,343,942 L130H probably damaging Het
Atp8b5 T A 4: 43,355,618 F533I probably damaging Het
Best1 A G 19: 9,986,779 V439A probably benign Het
Bicc1 A G 10: 70,961,148 V127A probably damaging Het
Brd7 T C 8: 88,347,004 T253A probably benign Het
Btd A G 14: 31,667,831 D503G probably benign Het
Ccdc80 A G 16: 45,104,441 E646G probably damaging Het
Ccl25 A G 8: 4,349,641 probably benign Het
Ccnf C A 17: 24,242,231 W150L probably damaging Het
Cdk11b A T 4: 155,641,567 probably benign Het
Cfap73 T C 5: 120,630,084 E203G probably benign Het
Cmya5 T C 13: 93,093,555 E1675G possibly damaging Het
Copg1 T A 6: 87,894,105 Y268N possibly damaging Het
Csnk2a1 T A 2: 152,260,812 H126Q probably damaging Het
Ctbs G A 3: 146,454,948 G90D probably damaging Het
Ctnna2 T C 6: 77,636,905 Y221C probably damaging Het
Cypt12 C T 3: 17,948,471 R3C unknown Het
D630003M21Rik A T 2: 158,216,750 M410K possibly damaging Het
Dnah9 A T 11: 65,981,231 N2724K probably benign Het
Dok3 T C 13: 55,524,284 T194A probably benign Het
Edem3 T G 1: 151,755,672 S36A probably benign Het
Eed C T 7: 89,980,519 E3K possibly damaging Het
Efcab2 A G 1: 178,481,360 I143V probably benign Het
Ensa A T 3: 95,627,048 probably null Het
Galnt16 A T 12: 80,580,052 E219V probably damaging Het
Gfra3 C A 18: 34,690,880 R347L probably benign Het
Gm13178 A C 4: 144,715,492 L63R probably damaging Het
Gm2042 T A 12: 87,960,239 I442K probably damaging Het
Gpld1 A T 13: 24,984,708 D735V probably damaging Het
Hspg2 T C 4: 137,542,269 S2253P possibly damaging Het
Kit T C 5: 75,620,967 I352T probably benign Het
Klra6 A T 6: 130,018,858 V179E possibly damaging Het
Lctl T A 9: 64,132,793 probably null Het
Lman1 C A 18: 65,991,643 V342L probably benign Het
Lrrn2 T C 1: 132,938,784 L529P probably damaging Het
Mab21l2 A G 3: 86,547,486 I69T probably benign Het
Mapkapk5 G T 5: 121,527,211 A327E probably benign Het
Mex3b G T 7: 82,869,872 R465L possibly damaging Het
Mgat3 A G 15: 80,212,454 N494S probably damaging Het
Mgat4c A G 10: 102,388,428 R168G possibly damaging Het
Mkks A G 2: 136,876,087 probably null Het
Muc16 G T 9: 18,554,919 H7368N unknown Het
Muc16 T C 9: 18,550,831 probably null Het
Nbeal1 G A 1: 60,261,586 probably null Het
Notch2 T C 3: 98,135,446 S1376P probably benign Het
Obox5 A G 7: 15,757,756 probably null Het
Olfr16 T C 1: 172,956,927 I44T probably benign Het
Olfr765 A T 10: 129,047,030 I11N probably damaging Het
Pbrm1 A G 14: 31,067,816 I807V probably damaging Het
Pitrm1 T A 13: 6,578,557 V962E probably damaging Het
Pkd2l1 T C 19: 44,154,208 Q465R probably damaging Het
Pla1a A G 16: 38,400,882 I372T probably damaging Het
Prmt5 A C 14: 54,515,388 F122C probably damaging Het
Prrc2b T A 2: 32,221,486 S1905T probably damaging Het
Ptprf T G 4: 118,223,904 K1163N probably benign Het
Raf1 T C 6: 115,620,339 probably null Het
Rnf180 T C 13: 105,270,921 E40G probably benign Het
Rpl6 T A 5: 121,208,909 M289K probably benign Het
Slc25a32 A G 15: 39,099,926 F167L probably benign Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Slc4a4 T A 5: 89,040,346 probably null Het
Sppl2a A G 2: 126,927,743 probably null Het
Tbr1 T A 2: 61,807,344 D82E probably benign Het
Tbx10 A T 19: 3,998,961 T291S probably benign Het
Tlr1 T A 5: 64,925,713 H507L possibly damaging Het
Trim37 A C 11: 87,167,509 T338P probably benign Het
Trpv5 T C 6: 41,653,270 T629A probably benign Het
Ttc14 T A 3: 33,803,497 I249N probably damaging Het
Uhrf1 A G 17: 56,320,450 T661A probably benign Het
Vmn2r65 A G 7: 84,947,379 I156T probably benign Het
Vwde T C 6: 13,186,906 N861D probably damaging Het
Zan A G 5: 137,423,951 C2802R unknown Het
Other mutations in Rab3ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Rab3ip APN 10 116907092 missense probably benign 0.09
IGL01946:Rab3ip APN 10 116937395 critical splice donor site probably null
IGL02665:Rab3ip APN 10 116937548 missense probably benign 0.02
R1538:Rab3ip UTSW 10 116939254 missense probably damaging 1.00
R1565:Rab3ip UTSW 10 116939223 missense probably benign 0.09
R1760:Rab3ip UTSW 10 116937510 missense probably damaging 1.00
R2077:Rab3ip UTSW 10 116918960 missense possibly damaging 0.87
R4441:Rab3ip UTSW 10 116915932 missense probably benign 0.19
R5442:Rab3ip UTSW 10 116918848 missense probably benign
R5526:Rab3ip UTSW 10 116918929 missense possibly damaging 0.61
R5682:Rab3ip UTSW 10 116907103 nonsense probably null
R5921:Rab3ip UTSW 10 116939247 missense probably damaging 1.00
R6254:Rab3ip UTSW 10 116915867 missense probably damaging 1.00
R7026:Rab3ip UTSW 10 116937536 missense probably benign 0.18
R7326:Rab3ip UTSW 10 116937633 missense probably benign 0.07
R7408:Rab3ip UTSW 10 116937641 missense possibly damaging 0.62
R7655:Rab3ip UTSW 10 116914139 missense probably benign 0.04
R7656:Rab3ip UTSW 10 116914139 missense probably benign 0.04
R8363:Rab3ip UTSW 10 116918964 missense probably damaging 1.00
R8537:Rab3ip UTSW 10 116910154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTGCTGTTGACCTCCTAC -3'
(R):5'- CTGGGTAGTATTTTACCACAAGATCAC -3'

Sequencing Primer
(F):5'- GCTGTTGACCTCCTACCTGATATTAG -3'
(R):5'- GCTTTATATGGATTGTTTTACAGCC -3'
Posted On2019-05-13