Mutagenetix > Incidental Mutation

Incidental Mutation 'R0609:Taf2'

54564

Institutional Source

Beutler Lab

Gene Symbol

Taf2

Ensembl Gene

ENSMUSG00000037343

Gene Name

TATA-box binding protein associated factor 2

Synonyms

CIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150

MMRRC Submission

038798-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0609 (G1)

Quality Score

218

Status

Not validated

Chromosome

Chromosomal Location

55015131-55072152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 55060050 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 277 (L277R)

Ref Sequence

ENSEMBL: ENSMUSP00000043733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041733]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000041733
AA Change: L277R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: L277R

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M1	21	406	5.6e-17	PFAM
SCOP:d1gw5a_	606	973	6e-7	SMART
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1142	1175	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226864

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930596D02Rik	A	T	14: 35,811,461		probably null	Het
Abcb4	T	A	5: 8,947,376	C952S	probably damaging	Het
Adamtsl2	A	G	2: 27,089,635	D272G	probably benign	Het
Aim2	G	A	1: 173,461,964	D158N	probably damaging	Het
Aldh3b1	C	T	19: 3,914,024	R426H	probably damaging	Het
Apoc2	A	G	7: 19,673,353	S28P	probably benign	Het
Arfgef3	G	A	10: 18,597,431	T1628I	probably benign	Het
Atp10a	G	A	7: 58,819,740		probably null	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Bmp8b	T	A	4: 123,121,899	D226E	probably benign	Het
Brsk2	T	C	7: 141,998,492	Y618H	probably damaging	Het
Casp12	T	A	9: 5,346,554	F27Y	probably damaging	Het
Casp8	T	A	1: 58,844,792	N439K	probably benign	Het
Ccdc175	T	A	12: 72,157,507	K253N	probably benign	Het
Cdc42bpa	A	G	1: 180,040,179	H193R	probably damaging	Het
Cdk17	T	C	10: 93,216,472	M105T	probably benign	Het
Cdon	C	A	9: 35,478,611	P854T	probably damaging	Het
Cep44	A	G	8: 56,544,152	M117T	possibly damaging	Het
Cep89	A	T	7: 35,435,530	E674D	probably damaging	Het
Cit	C	T	5: 115,873,943	A203V	probably damaging	Het
Clstn1	C	A	4: 149,629,300		probably null	Het
Col7a1	T	A	9: 108,958,147	D565E	unknown	Het
Cpb1	T	A	3: 20,262,474	Y304F	probably damaging	Het
Cps1	T	G	1: 67,172,802	Y710D	probably damaging	Het
Creb3l1	T	C	2: 91,987,053	T372A	possibly damaging	Het
Dars	A	G	1: 128,405,381	V102A	probably benign	Het
Dhx35	C	T	2: 158,817,415	T168I	possibly damaging	Het
Dnah5	T	C	15: 28,327,779	S2100P	probably benign	Het
Dst	T	C	1: 34,266,960		probably null	Het
Egflam	A	C	15: 7,253,523	L351R	possibly damaging	Het
Elp2	T	A	18: 24,626,156	D523E	probably benign	Het
Exo5	C	A	4: 120,921,684	G328V	probably damaging	Het
Fam208a	C	T	14: 27,461,750	T722I	probably benign	Het
Fut9	A	G	4: 25,620,811	M1T	probably null	Het
Galnt5	A	G	2: 58,024,625	N584S	possibly damaging	Het
Gbp3	T	C	3: 142,567,772	V360A	probably damaging	Het
Gdf6	G	A	4: 9,859,977	C353Y	probably damaging	Het
Gm13089	A	T	4: 143,698,503	D123E	probably benign	Het
Hace1	A	G	10: 45,648,869	T244A	probably damaging	Het
Hr	T	C	14: 70,559,657	I500T	probably benign	Het
Ifnl2	A	T	7: 28,509,282	L115Q	probably damaging	Het
Iigp1	T	C	18: 60,389,824	F5L	probably benign	Het
Inhbb	A	G	1: 119,417,416	L381P	probably damaging	Het
Irx3	A	T	8: 91,801,093	S50T	probably benign	Het
Ivns1abp	C	T	1: 151,360,145	T363I	probably benign	Het
Izumo1	A	T	7: 45,622,899	T35S	probably benign	Het
Kank4	A	G	4: 98,777,105	S651P	probably damaging	Het
Kit	T	C	5: 75,610,879	V232A	probably benign	Het
Klhl11	T	C	11: 100,463,714	Y427C	probably damaging	Het
Laptm4b	T	A	15: 34,258,689	N36K	probably damaging	Het
Lrrk1	T	C	7: 66,266,615		probably null	Het
Mamdc4	G	T	2: 25,564,193	Q1042K	probably benign	Het
Mical2	A	G	7: 112,321,440		probably null	Het
Ms4a3	C	A	19: 11,631,361	V176F	possibly damaging	Het
Myo3a	T	C	2: 22,333,513	V427A	probably benign	Het
Myo3a	A	C	2: 22,396,299	E626D	possibly damaging	Het
Nckap5	A	T	1: 126,027,288	L509*	probably null	Het
Ndufa5	A	T	6: 24,519,249	D64E	possibly damaging	Het
Nedd4l	T	C	18: 65,208,461	Y753H	probably damaging	Het
Nynrin	T	C	14: 55,872,761	V1775A	probably damaging	Het
Olfr141	A	G	2: 86,806,861	L46S	probably damaging	Het
Olfr292	T	C	7: 86,694,876	V140A	possibly damaging	Het
Olfr694	A	T	7: 106,688,998	H244Q	probably damaging	Het
Olfr735	T	C	14: 50,345,926	Y141C	probably damaging	Het
Olfr823	G	A	10: 130,112,580	S70F	probably damaging	Het
Oplah	A	G	15: 76,302,992	S570P	probably benign	Het
Osbpl11	C	A	16: 33,234,444	Y632*	probably null	Het
Osbpl5	A	T	7: 143,694,821	L644Q	probably damaging	Het
Pcdhb19	T	C	18: 37,497,952	W267R	probably benign	Het
Pkhd1l1	A	C	15: 44,467,424	S132R	possibly damaging	Het
Ptpn13	T	A	5: 103,556,145	S1348T	probably benign	Het
Rc3h1	T	A	1: 160,930,135	W8R	probably damaging	Het
Rgs3	T	G	4: 62,625,936	V315G	probably damaging	Het
Rora	T	A	9: 69,361,869	M82K	probably damaging	Het
Rph3al	T	C	11: 75,908,969	I55V	probably benign	Het
Sag	T	C	1: 87,812,991	V45A	probably damaging	Het
Scn3a	T	C	2: 65,536,510	E56G	probably damaging	Het
Sec24c	T	G	14: 20,686,948	V324G	probably damaging	Het
Sptbn1	A	G	11: 30,138,979	L748S	probably damaging	Het
Stard9	A	T	2: 120,706,306	D4186V	probably damaging	Het
Stk39	T	C	2: 68,366,167	E306G	probably damaging	Het
Sycp1	C	A	3: 102,898,849		probably null	Het
Tbc1d23	T	A	16: 57,173,106	I566F	possibly damaging	Het
Tekt5	T	C	16: 10,361,304	T400A	possibly damaging	Het
Tgfbrap1	T	C	1: 43,060,141	H401R	probably benign	Het
Tie1	T	A	4: 118,476,147	I841L	possibly damaging	Het
Tln1	T	G	4: 43,544,645	T1095P	possibly damaging	Het
Tmem147	A	G	7: 30,728,102	Y72H	probably benign	Het
Tnfaip2	A	G	12: 111,453,507	N691S	probably benign	Het
Trim24	G	A	6: 37,957,783	C811Y	probably damaging	Het
Trim30b	T	A	7: 104,357,976		probably benign	Het
Trpc4	T	G	3: 54,194,768	L29R	probably damaging	Het
Trpm6	A	T	19: 18,825,862	I890F	probably damaging	Het
Ttc23l	C	T	15: 10,504,536	E442K	probably benign	Het
Uggt2	A	G	14: 119,095,336	V62A	probably damaging	Het
Ugt1a6a	C	A	1: 88,138,884	S137R	probably benign	Het
Unc13a	A	G	8: 71,658,467	Y367H	probably damaging	Het
Vmn2r49	A	G	7: 9,976,306	I833T	probably benign	Het
Vmn2r7	T	C	3: 64,716,479	D231G	probably benign	Het
Ythdc2	A	T	18: 44,864,357	M994L	probably benign	Het
Zcchc6	A	T	13: 59,799,782	C506*	probably null	Het
Zfp804a	G	A	2: 82,257,588	S587N	probably damaging	Het
Zswim2	A	G	2: 83,923,659	I219T	probably benign	Het

Other mutations in Taf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Taf2	APN	15	55071449	critical splice acceptor site	probably null
IGL00475:Taf2	APN	15	55055850	nonsense	probably null
IGL00549:Taf2	APN	15	55031115	missense	probably benign	0.03
IGL00839:Taf2	APN	15	55045778	nonsense	probably null
IGL01089:Taf2	APN	15	55016581	missense	probably benign
IGL01305:Taf2	APN	15	55048274	missense	probably damaging	0.99
IGL01532:Taf2	APN	15	55049486	missense	possibly damaging	0.94
IGL01903:Taf2	APN	15	55060016	missense	probably benign	0.03
IGL02324:Taf2	APN	15	55028376	missense	probably benign
IGL02328:Taf2	APN	15	55028376	missense	probably benign
IGL02405:Taf2	APN	15	55034155	splice site	probably benign
IGL02671:Taf2	APN	15	55034176	missense	probably benign	0.01
IGL02832:Taf2	APN	15	55016563	missense	probably benign	0.01
IGL03105:Taf2	APN	15	55045799	missense	probably benign	0.26
IGL03118:Taf2	APN	15	55052163	missense	probably damaging	1.00
ANU22:Taf2	UTSW	15	55048274	missense	probably damaging	0.99
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0183:Taf2	UTSW	15	55055790	missense	possibly damaging	0.89
R0326:Taf2	UTSW	15	55047460	missense	probably damaging	0.97
R0362:Taf2	UTSW	15	55045929	missense	probably damaging	1.00
R0423:Taf2	UTSW	15	55064682	missense	probably benign	0.02
R0562:Taf2	UTSW	15	55022188	splice site	probably benign
R0655:Taf2	UTSW	15	55038294	missense	probably damaging	1.00
R0689:Taf2	UTSW	15	55063065	missense	possibly damaging	0.60
R0743:Taf2	UTSW	15	55016461	small deletion	probably benign
R0898:Taf2	UTSW	15	55060084	missense	probably damaging	0.97
R0969:Taf2	UTSW	15	55031157	critical splice acceptor site	probably null
R0974:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1160:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R1376:Taf2	UTSW	15	55016461	small deletion	probably benign
R1388:Taf2	UTSW	15	55036625	missense	probably benign	0.00
R1416:Taf2	UTSW	15	55038410	missense	possibly damaging	0.95
R1458:Taf2	UTSW	15	55059915	missense	probably damaging	0.99
R1477:Taf2	UTSW	15	55062172	missense	possibly damaging	0.87
R1755:Taf2	UTSW	15	55016454	missense	probably damaging	1.00
R1766:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R2090:Taf2	UTSW	15	55016486	missense	probably damaging	0.99
R2228:Taf2	UTSW	15	55064646	missense	possibly damaging	0.94
R2519:Taf2	UTSW	15	55052247	missense	probably benign	0.03
R4073:Taf2	UTSW	15	55052237	missense	probably damaging	1.00
R4470:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4471:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4472:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4716:Taf2	UTSW	15	55065968	missense	probably benign	0.02
R4937:Taf2	UTSW	15	55027223	nonsense	probably null
R5082:Taf2	UTSW	15	55060045	missense	probably benign	0.41
R5335:Taf2	UTSW	15	55045740	missense	probably benign	0.14
R5383:Taf2	UTSW	15	55049419	missense	possibly damaging	0.78
R5771:Taf2	UTSW	15	55059939	missense	probably benign	0.01
R5862:Taf2	UTSW	15	55048323	missense	possibly damaging	0.95
R5873:Taf2	UTSW	15	55038422	missense	probably benign	0.00
R5908:Taf2	UTSW	15	55072006	unclassified	probably benign
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6159:Taf2	UTSW	15	55063044	missense	possibly damaging	0.48
R6568:Taf2	UTSW	15	55064630	missense	probably damaging	1.00
R7094:Taf2	UTSW	15	55060086	missense	probably benign	0.27
R7174:Taf2	UTSW	15	55048739	missense	possibly damaging	0.51
R7241:Taf2	UTSW	15	55062141	missense	probably benign	0.01
R7561:Taf2	UTSW	15	55055833	missense	probably benign	0.16
R7583:Taf2	UTSW	15	55064676	nonsense	probably null
R7818:Taf2	UTSW	15	55065930	missense	probably benign
R7905:Taf2	UTSW	15	55047432	missense	possibly damaging	0.90
R8006:Taf2	UTSW	15	55048701	missense	probably damaging	1.00
R8017:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8019:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8119:Taf2	UTSW	15	55031130	missense	probably benign	0.00
R8127:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8128:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8129:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8278:Taf2	UTSW	15	55065965	nonsense	probably null
R8290:Taf2	UTSW	15	55063020	missense	probably damaging	1.00
R8762:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R8832:Taf2	UTSW	15	55064605	missense	possibly damaging	0.86
R8916:Taf2	UTSW	15	55036535	missense	probably benign	0.26
R8937:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R9006:Taf2	UTSW	15	55045905	missense	possibly damaging	0.94
R9138:Taf2	UTSW	15	55016461	small deletion	probably benign
R9240:Taf2	UTSW	15	55063068	missense	probably null	1.00
R9257:Taf2	UTSW	15	55066013	missense	possibly damaging	0.46
R9485:Taf2	UTSW	15	55048271	missense	probably benign	0.05
R9762:Taf2	UTSW	15	55031044	critical splice donor site	probably null
R9766:Taf2	UTSW	15	55047485	critical splice acceptor site	probably null
R9796:Taf2	UTSW	15	55047436	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGGCATCCTCTACTTGAAGGGAC -3'
(R):5'- CGTTGGGCATGTGAAAGCCATTG -3'

Sequencing Primer
(F):5'- TTGAAGGGACACCAACCTG -3'
(R):5'- GACACATAAGAGATTATGCTAAGCC -3'

Posted On

2013-07-11