Incidental Mutation 'R7021:Prmt5'
ID545651
Institutional Source Beutler Lab
Gene Symbol Prmt5
Ensembl Gene ENSMUSG00000023110
Gene Nameprotein arginine N-methyltransferase 5
SynonymsJak-binding protein 1, Jbp1, Skb1
MMRRC Submission
Accession Numbers

Genbank: NM_013768.3; Ensembl: ENSMUST00000023873

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7021 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54507187-54517525 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 54515388 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 122 (F122C)
Ref Sequence ENSEMBL: ENSMUSP00000023873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023873] [ENSMUST00000132227] [ENSMUST00000147214]
Predicted Effect probably damaging
Transcript: ENSMUST00000023873
AA Change: F122C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023873
Gene: ENSMUSG00000023110
AA Change: F122C

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
Pfam:PRMT5 181 619 4.5e-184 PFAM
Pfam:SAMBD 184 465 3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132227
SMART Domains Protein: ENSMUSP00000138549
Gene: ENSMUSG00000023110

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
PDB:4GQB|A 19 40 5e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000139964
SMART Domains Protein: ENSMUSP00000121502
Gene: ENSMUSG00000023110

DomainStartEndE-ValueType
Pfam:PRMT5 1 62 1.3e-10 PFAM
Pfam:SAMBD 1 203 4.6e-68 PFAM
Pfam:PRMT5 52 203 1.2e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147214
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: This gene encodes an enzyme that belongs to the methyltransferase family. The encoded protein catalyzes the transfer of methyl groups to the amino acid arginine, in target proteins that include histones, transcriptional elongation factors and the tumor suppressor p53. This gene plays a role in several cellular processes, including transcriptional regulation and the assembly of small nuclear ribonucleoproteins. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation with failure of inner cell mass proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(4) Gene trapped(5)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 C T 12: 118,931,925 V379I probably benign Het
Adamts15 T C 9: 30,921,480 Y253C probably damaging Het
Ahsa1 T C 12: 87,271,380 S37P possibly damaging Het
Arnt2 A T 7: 84,343,942 L130H probably damaging Het
Atp8b5 T A 4: 43,355,618 F533I probably damaging Het
Best1 A G 19: 9,986,779 V439A probably benign Het
Bicc1 A G 10: 70,961,148 V127A probably damaging Het
Brd7 T C 8: 88,347,004 T253A probably benign Het
Btd A G 14: 31,667,831 D503G probably benign Het
Ccdc80 A G 16: 45,104,441 E646G probably damaging Het
Ccl25 A G 8: 4,349,641 probably benign Het
Ccnf C A 17: 24,242,231 W150L probably damaging Het
Cdk11b A T 4: 155,641,567 probably benign Het
Cfap73 T C 5: 120,630,084 E203G probably benign Het
Cmya5 T C 13: 93,093,555 E1675G possibly damaging Het
Copg1 T A 6: 87,894,105 Y268N possibly damaging Het
Csnk2a1 T A 2: 152,260,812 H126Q probably damaging Het
Ctbs G A 3: 146,454,948 G90D probably damaging Het
Ctnna2 T C 6: 77,636,905 Y221C probably damaging Het
Cypt12 C T 3: 17,948,471 R3C unknown Het
D630003M21Rik A T 2: 158,216,750 M410K possibly damaging Het
Dnah9 A T 11: 65,981,231 N2724K probably benign Het
Dok3 T C 13: 55,524,284 T194A probably benign Het
Edem3 T G 1: 151,755,672 S36A probably benign Het
Eed C T 7: 89,980,519 E3K possibly damaging Het
Efcab2 A G 1: 178,481,360 I143V probably benign Het
Ensa A T 3: 95,627,048 probably null Het
Galnt16 A T 12: 80,580,052 E219V probably damaging Het
Gfra3 C A 18: 34,690,880 R347L probably benign Het
Gm13178 A C 4: 144,715,492 L63R probably damaging Het
Gm2042 T A 12: 87,960,239 I442K probably damaging Het
Gpld1 A T 13: 24,984,708 D735V probably damaging Het
Hspg2 T C 4: 137,542,269 S2253P possibly damaging Het
Kit T C 5: 75,620,967 I352T probably benign Het
Klra6 A T 6: 130,018,858 V179E possibly damaging Het
Lctl T A 9: 64,132,793 probably null Het
Lman1 C A 18: 65,991,643 V342L probably benign Het
Lrrn2 T C 1: 132,938,784 L529P probably damaging Het
Mab21l2 A G 3: 86,547,486 I69T probably benign Het
Mapkapk5 G T 5: 121,527,211 A327E probably benign Het
Mex3b G T 7: 82,869,872 R465L possibly damaging Het
Mgat3 A G 15: 80,212,454 N494S probably damaging Het
Mgat4c A G 10: 102,388,428 R168G possibly damaging Het
Mkks A G 2: 136,876,087 probably null Het
Muc16 G T 9: 18,554,919 H7368N unknown Het
Muc16 T C 9: 18,550,831 probably null Het
Nbeal1 G A 1: 60,261,586 probably null Het
Notch2 T C 3: 98,135,446 S1376P probably benign Het
Obox5 A G 7: 15,757,756 probably null Het
Olfr16 T C 1: 172,956,927 I44T probably benign Het
Olfr765 A T 10: 129,047,030 I11N probably damaging Het
Pbrm1 A G 14: 31,067,816 I807V probably damaging Het
Pitrm1 T A 13: 6,578,557 V962E probably damaging Het
Pkd2l1 T C 19: 44,154,208 Q465R probably damaging Het
Pla1a A G 16: 38,400,882 I372T probably damaging Het
Prrc2b T A 2: 32,221,486 S1905T probably damaging Het
Ptprf T G 4: 118,223,904 K1163N probably benign Het
Rab3ip A G 10: 116,939,378 V25A probably damaging Het
Raf1 T C 6: 115,620,339 probably null Het
Rnf180 T C 13: 105,270,921 E40G probably benign Het
Rpl6 T A 5: 121,208,909 M289K probably benign Het
Slc25a32 A G 15: 39,099,926 F167L probably benign Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Slc4a4 T A 5: 89,040,346 probably null Het
Sppl2a A G 2: 126,927,743 probably null Het
Tbr1 T A 2: 61,807,344 D82E probably benign Het
Tbx10 A T 19: 3,998,961 T291S probably benign Het
Tlr1 T A 5: 64,925,713 H507L possibly damaging Het
Trim37 A C 11: 87,167,509 T338P probably benign Het
Trpv5 T C 6: 41,653,270 T629A probably benign Het
Ttc14 T A 3: 33,803,497 I249N probably damaging Het
Uhrf1 A G 17: 56,320,450 T661A probably benign Het
Vmn2r65 A G 7: 84,947,379 I156T probably benign Het
Vwde T C 6: 13,186,906 N861D probably damaging Het
Zan A G 5: 137,423,951 C2802R unknown Het
Other mutations in Prmt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Prmt5 APN 14 54509877 missense probably damaging 1.00
IGL01586:Prmt5 APN 14 54509951 unclassified probably benign
IGL02063:Prmt5 APN 14 54511020 nonsense probably null
IGL02249:Prmt5 APN 14 54509865 missense probably damaging 1.00
IGL03024:Prmt5 APN 14 54516598 missense possibly damaging 0.93
skipper UTSW 14 54509911 missense probably damaging 1.00
1mM(1):Prmt5 UTSW 14 54511500 critical splice donor site probably null
R0485:Prmt5 UTSW 14 54511255 missense probably damaging 1.00
R0664:Prmt5 UTSW 14 54507856 missense probably damaging 0.99
R1473:Prmt5 UTSW 14 54508915 missense probably damaging 1.00
R2106:Prmt5 UTSW 14 54507917 missense probably benign 0.00
R2159:Prmt5 UTSW 14 54515338 missense probably benign 0.03
R4728:Prmt5 UTSW 14 54507907 missense probably benign 0.00
R4843:Prmt5 UTSW 14 54516125 missense probably benign 0.33
R5261:Prmt5 UTSW 14 54507916 missense probably damaging 0.96
R5277:Prmt5 UTSW 14 54509942 missense probably benign 0.02
R5736:Prmt5 UTSW 14 54514840 missense probably null 0.84
R5892:Prmt5 UTSW 14 54509911 missense probably damaging 1.00
R5945:Prmt5 UTSW 14 54514887 missense possibly damaging 0.52
R7091:Prmt5 UTSW 14 54511342 splice site probably null
R7172:Prmt5 UTSW 14 54514886 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACAACACTGACATTTCAATTCTGCC -3'
(R):5'- GCTCAGTATGGCAGCTTATAGC -3'

Sequencing Primer
(F):5'- CTGACATTTCAATTCTGCCAAATGC -3'
(R):5'- GATTTCTGAGTTCAAGGCCAGCC -3'
Posted On2019-05-13