Mutagenetix > Incidental Mutation

Incidental Mutation 'R7022:Kif1a'

545664

Institutional Source

Beutler Lab

Gene Symbol

Kif1a

Ensembl Gene

ENSMUSG00000014602

Gene Name

kinesin family member 1A

Synonyms

LOC381283, N-3 kinesin, ATSV, C630002N23Rik, Kns1

MMRRC Submission

Accession Numbers

Genbank: NM_008440.3, NM_001110315.1

Is this an essential gene?

Probably essential (E-score: 0.912) question?

Stock #

R7022 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

93015464-93101951 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 93066098 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 377 (T377P)

Ref Sequence

ENSEMBL: ENSMUSP00000140163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000190723]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000086819
AA Change: T377P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602
AA Change: T377P

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	411	429	N/A	INTRINSIC
FHA	524	581	1.39e-8	SMART
coiled coil region	634	688	N/A	INTRINSIC
low complexity region	693	706	N/A	INTRINSIC
low complexity region	762	778	N/A	INTRINSIC
Pfam:KIF1B	814	861	6.4e-13	PFAM
Pfam:DUF3694	1157	1305	1.8e-47	PFAM
low complexity region	1420	1444	N/A	INTRINSIC
low complexity region	1541	1549	N/A	INTRINSIC
PH	1584	1683	1.52e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112958
AA Change: T377P

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602
AA Change: T377P

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	851	3.9e-15	PFAM
Pfam:DUF3694	1148	1304	5e-40	PFAM
low complexity region	1420	1444	N/A	INTRINSIC
low complexity region	1541	1549	N/A	INTRINSIC
PH	1584	1683	1.52e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171556
AA Change: T377P

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602
AA Change: T377P

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	852	2.7e-13	PFAM
Pfam:DUF3694	1148	1296	8.4e-48	PFAM
low complexity region	1411	1435	N/A	INTRINSIC
low complexity region	1532	1540	N/A	INTRINSIC
PH	1575	1674	1.52e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171796
AA Change: T377P

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602
AA Change: T377P

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	852	6.4e-13	PFAM
Pfam:DUF3694	1148	1304	1.8e-46	PFAM
low complexity region	1419	1443	N/A	INTRINSIC
low complexity region	1540	1548	N/A	INTRINSIC
PH	1583	1682	1.52e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190723
AA Change: T377P

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602
AA Change: T377P

Domain	Start	End	E-Value	Type
KISc	3	362	5.2e-180	SMART
low complexity region	411	429	N/A	INTRINSIC
coiled coil region	438	471	N/A	INTRINSIC
FHA	524	581	6.9e-11	SMART
coiled coil region	634	688	N/A	INTRINSIC
low complexity region	693	706	N/A	INTRINSIC
low complexity region	762	778	N/A	INTRINSIC
Pfam:KIF1B	814	861	4e-10	PFAM
low complexity region	885	900	N/A	INTRINSIC
coiled coil region	901	929	N/A	INTRINSIC
internal_repeat_1	938	957	5.9e-5	PROSPERO
Pfam:DUF3694	1250	1398	1.1e-44	PFAM
low complexity region	1513	1537	N/A	INTRINSIC
low complexity region	1634	1642	N/A	INTRINSIC
PH	1677	1776	6.9e-16	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	T	11: 110,083,500	S203T	probably damaging	Het
Adat1	A	T	8: 111,989,862	M76K	probably damaging	Het
Ankrd33	G	C	15: 101,116,899	V56L	probably benign	Het
Ascc3	T	A	10: 50,716,629	L1134I	possibly damaging	Het
C3	T	G	17: 57,217,286	D948A	probably damaging	Het
Ccdc40	A	G	11: 119,231,786	E138G	possibly damaging	Het
Cd80	A	G	16: 38,486,504		probably null	Het
Cdca7	T	A	2: 72,479,529		probably null	Het
Chit1	A	G	1: 134,151,292	S447G	probably benign	Het
Cmya5	C	T	13: 93,069,278		probably null	Het
Cnnm2	T	A	19: 46,858,940		probably null	Het
Cnnm2	A	T	19: 46,762,550	I260F	probably damaging	Het
Col1a2	T	C	6: 4,534,639	L881P	unknown	Het
Crebbp	A	T	16: 4,117,323	S901T	probably damaging	Het
Dcun1d2	T	C	8: 13,271,637	Y158C	probably damaging	Het
Dnhd1	C	T	7: 105,720,798	P4477S	probably benign	Het
Donson	A	G	16: 91,681,330	Y428H	probably damaging	Het
Dsp	G	T	13: 38,191,740	W1167L	probably benign	Het
Elmo2	C	T	2: 165,295,041	V592M	probably damaging	Het
Enpp3	T	A	10: 24,826,195	E60D	probably damaging	Het
Fam83b	TAAGA	T	9: 76,502,112		probably null	Het
Fbxo38	A	G	18: 62,536,224	C52R	probably damaging	Het
Gm10912	T	C	2: 104,066,710	W65R	probably damaging	Het
Gm43518	A	T	5: 123,936,427	M44L	probably benign	Het
Gm4881	A	T	7: 24,931,664		probably null	Het
Gm6583	A	C	5: 112,355,529	M103R	probably benign	Het
Gnb1	T	A	4: 155,553,456	D212E	probably damaging	Het
Gnl1	A	G	17: 35,988,728	N597S	probably damaging	Het
Gprin1	T	G	13: 54,739,042	E473A	probably benign	Het
Ighv1-69	T	A	12: 115,623,214	M100L	probably benign	Het
Igkv14-100	T	C	6: 68,519,209	S29P	probably damaging	Het
Ints6	A	G	14: 62,714,337	V232A	probably damaging	Het
Jup	A	G	11: 100,379,553	L376P	probably damaging	Het
Kdr	A	T	5: 75,972,260	Y119*	probably null	Het
Lama5	C	A	2: 180,180,731	V2850L	probably damaging	Het
Lrp2	T	C	2: 69,483,208	Y2393C	probably damaging	Het
Mfsd13a	C	T	19: 46,368,324	Q255*	probably null	Het
Msh3	A	C	13: 92,235,588	D891E	probably damaging	Het
Msl2	A	G	9: 101,075,282	N2D	possibly damaging	Het
Myo19	T	C	11: 84,900,547	L476P	probably damaging	Het
Nbeal2	G	A	9: 110,638,618	R501W	probably damaging	Het
Nfasc	C	A	1: 132,621,049	K293N	probably damaging	Het
Npbwr1	A	T	1: 5,917,100	L65Q	probably damaging	Het
Nrbp1	T	A	5: 31,244,481	D34E	probably damaging	Het
Nup205	T	A	6: 35,243,936	V1891D	probably benign	Het
Olfr172	T	C	16: 58,761,119	N19S	probably benign	Het
Olfr577	T	A	7: 102,973,968	N8I	possibly damaging	Het
Olfr936	G	T	9: 39,047,083	C156*	probably null	Het
Olfr998	T	A	2: 85,590,598	D19E	probably benign	Het
Oscp1	G	A	4: 126,082,990		probably null	Het
Pcdhgb7	A	G	18: 37,753,033	T419A	probably damaging	Het
Pdzph1	T	C	17: 58,974,126	D387G	probably benign	Het
Phc1	A	G	6: 122,335,031	F56S	probably damaging	Het
Pik3c2g	A	G	6: 139,622,063	E59G	possibly damaging	Het
Prickle1	G	T	15: 93,500,871	T692K	possibly damaging	Het
Rbm45	T	A	2: 76,376,394	L250Q	probably damaging	Het
Ror1	T	A	4: 100,407,911	M194K	probably damaging	Het
Rrbp1	T	A	2: 143,957,802		probably null	Het
Rundc3b	T	C	5: 8,512,348	K340R	probably null	Het
Scn1a	T	A	2: 66,317,899	T1101S	probably damaging	Het
Sdk1	C	G	5: 142,094,657		probably null	Het
Skiv2l	A	G	17: 34,845,207	F501S	possibly damaging	Het
Slc20a1	T	A	2: 129,200,059	M114K	probably damaging	Het
Sorl1	A	C	9: 41,969,751	I2158S	probably benign	Het
Strip1	A	T	3: 107,626,795	F174L	probably benign	Het
Sucnr1	A	T	3: 60,086,278	I76L	probably benign	Het
Syt17	C	T	7: 118,408,019	V412I	probably benign	Het
Tie1	T	A	4: 118,489,653	H18L	probably benign	Het
Tpp1	T	G	7: 105,748,922	K345Q	probably damaging	Het
Trcg1	G	A	9: 57,241,569	M141I	possibly damaging	Het
Trpc4ap	T	C	2: 155,657,822	N260S	probably benign	Het
Vps41	C	A	13: 18,842,268	T512K	possibly damaging	Het
Vps52	A	T	17: 33,959,319	M147L	probably benign	Het
Ywhaq	A	G	12: 21,391,751		probably benign	Het
Zfp619	A	G	7: 39,534,963	N139S	probably benign	Het

Other mutations in Kif1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Kif1a	APN	1	93054934	missense	probably damaging	1.00
IGL01574:Kif1a	APN	1	93082340	missense	probably damaging	1.00
IGL01637:Kif1a	APN	1	93039853	missense	possibly damaging	0.95
IGL01895:Kif1a	APN	1	93025733	missense	possibly damaging	0.65
IGL02215:Kif1a	APN	1	93020549	missense	probably benign	0.05
IGL02571:Kif1a	APN	1	93020456	critical splice donor site	probably null
IGL02734:Kif1a	APN	1	93062558	missense	probably damaging	1.00
IGL02752:Kif1a	APN	1	93039847	missense	possibly damaging	0.92
IGL02990:Kif1a	APN	1	93039263	missense	probably damaging	1.00
IGL03298:Kif1a	APN	1	93066181	missense	probably damaging	1.00
IGL03309:Kif1a	APN	1	93058857	nonsense	probably null
IGL03354:Kif1a	APN	1	93060235	missense	probably damaging	1.00
asbestos	UTSW	1	93022505	missense	probably damaging	1.00
chrysolite	UTSW	1	93074948	splice site	probably benign
osmium	UTSW	1	93058810	splice site	probably benign
R4538_Kif1a_397	UTSW	1	93077047	missense	probably damaging	1.00
1mM(1):Kif1a	UTSW	1	93077068	missense	probably benign	0.00
IGL03046:Kif1a	UTSW	1	93082406	missense	probably damaging	1.00
PIT4508001:Kif1a	UTSW	1	93046729	missense	probably damaging	1.00
R0025:Kif1a	UTSW	1	93042358	missense	probably damaging	1.00
R0115:Kif1a	UTSW	1	93046778	splice site	probably benign
R0243:Kif1a	UTSW	1	93042093	missense	probably damaging	1.00
R0270:Kif1a	UTSW	1	93054442	splice site	probably benign
R0335:Kif1a	UTSW	1	93052566	splice site	probably benign
R0380:Kif1a	UTSW	1	93056031	critical splice acceptor site	probably null
R0472:Kif1a	UTSW	1	93018997	missense	probably damaging	0.99
R0501:Kif1a	UTSW	1	93056245	missense	probably damaging	1.00
R0538:Kif1a	UTSW	1	93043638	missense	probably damaging	0.99
R0628:Kif1a	UTSW	1	93019883	missense	probably damaging	1.00
R0848:Kif1a	UTSW	1	93019898	missense	probably damaging	1.00
R1110:Kif1a	UTSW	1	93023453	splice site	probably benign
R1132:Kif1a	UTSW	1	93056021	missense	probably damaging	0.99
R1387:Kif1a	UTSW	1	93055950	splice site	probably benign
R1466:Kif1a	UTSW	1	93054929	missense	possibly damaging	0.68
R1466:Kif1a	UTSW	1	93054929	missense	possibly damaging	0.68
R1544:Kif1a	UTSW	1	93074948	splice site	probably benign
R1569:Kif1a	UTSW	1	93058810	splice site	probably benign
R1802:Kif1a	UTSW	1	93066149	missense	probably damaging	1.00
R1917:Kif1a	UTSW	1	93019031	missense	possibly damaging	0.95
R1919:Kif1a	UTSW	1	93019031	missense	possibly damaging	0.95
R1999:Kif1a	UTSW	1	93060795	missense	probably damaging	0.98
R2000:Kif1a	UTSW	1	93054329	missense	probably damaging	0.99
R2276:Kif1a	UTSW	1	93068477	splice site	probably benign
R2307:Kif1a	UTSW	1	93078769	missense	probably damaging	1.00
R2919:Kif1a	UTSW	1	93046742	missense	probably damaging	1.00
R3440:Kif1a	UTSW	1	93036853	missense	possibly damaging	0.53
R3441:Kif1a	UTSW	1	93036853	missense	possibly damaging	0.53
R3618:Kif1a	UTSW	1	93077043	missense	probably null	1.00
R3957:Kif1a	UTSW	1	93025694	missense	probably damaging	1.00
R4010:Kif1a	UTSW	1	93022409	missense	probably benign	0.42
R4013:Kif1a	UTSW	1	93076292	missense	probably damaging	1.00
R4017:Kif1a	UTSW	1	93076292	missense	probably damaging	1.00
R4115:Kif1a	UTSW	1	93052538	missense	probably damaging	1.00
R4386:Kif1a	UTSW	1	93068550	missense	probably damaging	1.00
R4538:Kif1a	UTSW	1	93077047	missense	probably damaging	1.00
R4608:Kif1a	UTSW	1	93024646	missense	possibly damaging	0.81
R4625:Kif1a	UTSW	1	93042659	missense	probably benign	0.00
R4701:Kif1a	UTSW	1	93078835	missense	probably damaging	0.99
R4794:Kif1a	UTSW	1	93025727	missense	probably damaging	1.00
R4830:Kif1a	UTSW	1	93021209	splice site	probably null
R4903:Kif1a	UTSW	1	93021734	missense	probably damaging	1.00
R4915:Kif1a	UTSW	1	93074978	missense	probably benign	0.21
R4918:Kif1a	UTSW	1	93074978	missense	probably benign	0.21
R4991:Kif1a	UTSW	1	93078808	missense	probably benign	0.00
R5028:Kif1a	UTSW	1	93054327	missense	possibly damaging	0.68
R5051:Kif1a	UTSW	1	93076154	splice site	probably null
R5073:Kif1a	UTSW	1	93022505	missense	probably damaging	1.00
R5103:Kif1a	UTSW	1	93046696	missense	probably damaging	1.00
R5314:Kif1a	UTSW	1	93018498	missense	probably damaging	1.00
R5481:Kif1a	UTSW	1	93060244	missense	probably benign	0.01
R5510:Kif1a	UTSW	1	93041692	missense	possibly damaging	0.93
R5610:Kif1a	UTSW	1	93025728	missense	probably damaging	1.00
R5643:Kif1a	UTSW	1	93055767	missense	probably damaging	0.98
R5808:Kif1a	UTSW	1	93042698	missense	probably damaging	0.99
R6027:Kif1a	UTSW	1	93025643	missense	probably benign	0.33
R6056:Kif1a	UTSW	1	93024648	missense	probably damaging	1.00
R6077:Kif1a	UTSW	1	93054896	missense	possibly damaging	0.54
R6120:Kif1a	UTSW	1	93024574	splice site	probably null
R6126:Kif1a	UTSW	1	93019899	missense	probably damaging	1.00
R6130:Kif1a	UTSW	1	93036901	missense	probably damaging	1.00
R6255:Kif1a	UTSW	1	93019983	missense	probably damaging	1.00
R6301:Kif1a	UTSW	1	93054941	nonsense	probably null
R6326:Kif1a	UTSW	1	93076326	missense	probably damaging	1.00
R6594:Kif1a	UTSW	1	93021313	missense	probably benign	0.00
R6653:Kif1a	UTSW	1	93077698	missense	probably damaging	1.00
R6791:Kif1a	UTSW	1	93066137	missense	probably damaging	1.00
R6853:Kif1a	UTSW	1	93039802	missense	possibly damaging	0.47
R7059:Kif1a	UTSW	1	93046829	intron	probably benign
R7103:Kif1a	UTSW	1	93077785	missense	probably damaging	1.00
R7248:Kif1a	UTSW	1	93041583	missense	probably benign	0.35
R7259:Kif1a	UTSW	1	93073810	nonsense	probably null
R7424:Kif1a	UTSW	1	93054317	missense	possibly damaging	0.89
R7659:Kif1a	UTSW	1	93046820	intron	probably benign
R7681:Kif1a	UTSW	1	93054944	missense	probably benign
R7976:Kif1a	UTSW	1	93039774	missense	probably damaging	1.00
R8056:Kif1a	UTSW	1	93054701	intron	probably benign
R8420:Kif1a	UTSW	1	93022419	missense	probably benign
R8994:Kif1a	UTSW	1	93055735	missense	possibly damaging	0.77
R9016:Kif1a	UTSW	1	93025673	missense	probably damaging	1.00
R9206:Kif1a	UTSW	1	93051480	missense	probably damaging	0.99
R9246:Kif1a	UTSW	1	93077779	missense	probably damaging	0.98
R9252:Kif1a	UTSW	1	93075054	missense	probably damaging	1.00
R9388:Kif1a	UTSW	1	93072307	critical splice donor site	probably null
R9413:Kif1a	UTSW	1	93021297	missense	probably benign	0.00
R9612:Kif1a	UTSW	1	93025694	missense	probably damaging	1.00
R9621:Kif1a	UTSW	1	93055723	missense	probably benign
R9625:Kif1a	UTSW	1	93073044	missense	probably benign	0.42
Z1176:Kif1a	UTSW	1	93021316	missense	probably damaging	0.97
Z1176:Kif1a	UTSW	1	93022491	missense	probably damaging	1.00
Z1176:Kif1a	UTSW	1	93055697	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGCAACTTCAGCACTTCCTG -3'
(R):5'- AGCCTAGGTCAAATATTTTCTCCC -3'

Sequencing Primer
(F):5'- GCACTTCCTGACAAATGTGG -3'
(R):5'- CCAGCTGCTCTCCAGATATG -3'

Posted On

2019-05-13