Mutagenetix > Incidental Mutations

Incidental Mutation 'R7022:Vps41'

545712

Institutional Source

Beutler Lab

Gene Symbol

Vps41

Ensembl Gene

ENSMUSG00000041236

Gene Name

VPS41 HOPS complex subunit

Synonyms

Vam2, mVam2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7022 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18717286-18866811 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 18842268 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 512 (T512K)

Ref Sequence

ENSEMBL: ENSMUSP00000072729 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072961]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072961
AA Change: T512K

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000072729
Gene: ENSMUSG00000041236
AA Change: T512K

Domain	Start	End	E-Value	Type
low complexity region	3	26	N/A	INTRINSIC
Blast:WD40	34	70	2e-7	BLAST
SCOP:d1flga_	44	253	6e-9	SMART
Blast:WD40	159	195	3e-11	BLAST
CLH	570	711	1.92e-42	SMART
RING	790	837	8.98e-2	SMART

Meta Mutation Damage Score

0.1712

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human ortholog of yeast Vps41 protein which is also conserved in Drosophila, tomato, and Arabidopsis. Expression studies in yeast and human indicate that this protein may be involved in the formation and fusion of transport vesicles from the Golgi. Several transcript variants encoding different isoforms have been described for this gene, however, the full-length nature of not all is known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele die by E9 exhibiting morphological and functional alteration of late endocytic compartments, and abnormal triploblastic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	T	11: 110,083,500	S203T	probably damaging	Het
Adat1	A	T	8: 111,989,862	M76K	probably damaging	Het
Ankrd33	G	C	15: 101,116,899	V56L	probably benign	Het
Ascc3	T	A	10: 50,716,629	L1134I	possibly damaging	Het
C3	T	G	17: 57,217,286	D948A	probably damaging	Het
Ccdc40	A	G	11: 119,231,786	E138G	possibly damaging	Het
Cd80	A	G	16: 38,486,504		probably null	Het
Cdca7	T	A	2: 72,479,529		probably null	Het
Chit1	A	G	1: 134,151,292	S447G	probably benign	Het
Cmya5	C	T	13: 93,069,278		probably null	Het
Cnnm2	T	A	19: 46,858,940		probably null	Het
Cnnm2	A	T	19: 46,762,550	I260F	probably damaging	Het
Col1a2	T	C	6: 4,534,639	L881P	unknown	Het
Crebbp	A	T	16: 4,117,323	S901T	probably damaging	Het
Dcun1d2	T	C	8: 13,271,637	Y158C	probably damaging	Het
Dnhd1	C	T	7: 105,720,798	P4477S	probably benign	Het
Donson	A	G	16: 91,681,330	Y428H	probably damaging	Het
Dsp	G	T	13: 38,191,740	W1167L	probably benign	Het
Elmo2	C	T	2: 165,295,041	V592M	probably damaging	Het
Enpp3	T	A	10: 24,826,195	E60D	probably damaging	Het
Fam83b	TAAGA	T	9: 76,502,112		probably null	Het
Fbxo38	A	G	18: 62,536,224	C52R	probably damaging	Het
Gm10912	T	C	2: 104,066,710	W65R	probably damaging	Het
Gm43518	A	T	5: 123,936,427	M44L	probably benign	Het
Gm4881	A	T	7: 24,931,664		probably null	Het
Gm6583	A	C	5: 112,355,529	M103R	probably benign	Het
Gnb1	T	A	4: 155,553,456	D212E	probably damaging	Het
Gnl1	A	G	17: 35,988,728	N597S	probably damaging	Het
Gprin1	T	G	13: 54,739,042	E473A	probably benign	Het
Ighv1-69	T	A	12: 115,623,214	M100L	probably benign	Het
Igkv14-100	T	C	6: 68,519,209	S29P	probably damaging	Het
Ints6	A	G	14: 62,714,337	V232A	probably damaging	Het
Jup	A	G	11: 100,379,553	L376P	probably damaging	Het
Kdr	A	T	5: 75,972,260	Y119*	probably null	Het
Kif1a	T	G	1: 93,066,098	T377P	probably benign	Het
Lama5	C	A	2: 180,180,731	V2850L	probably damaging	Het
Lrp2	T	C	2: 69,483,208	Y2393C	probably damaging	Het
Mfsd13a	C	T	19: 46,368,324	Q255*	probably null	Het
Msh3	A	C	13: 92,235,588	D891E	probably damaging	Het
Msl2	A	G	9: 101,075,282	N2D	possibly damaging	Het
Myo19	T	C	11: 84,900,547	L476P	probably damaging	Het
Nbeal2	G	A	9: 110,638,618	R501W	probably damaging	Het
Nfasc	C	A	1: 132,621,049	K293N	probably damaging	Het
Npbwr1	A	T	1: 5,917,100	L65Q	probably damaging	Het
Nrbp1	T	A	5: 31,244,481	D34E	probably damaging	Het
Nup205	T	A	6: 35,243,936	V1891D	probably benign	Het
Olfr172	T	C	16: 58,761,119	N19S	probably benign	Het
Olfr577	T	A	7: 102,973,968	N8I	possibly damaging	Het
Olfr936	G	T	9: 39,047,083	C156*	probably null	Het
Olfr998	T	A	2: 85,590,598	D19E	probably benign	Het
Oscp1	G	A	4: 126,082,990		probably null	Het
Pcdhgb7	A	G	18: 37,753,033	T419A	probably damaging	Het
Pdzph1	T	C	17: 58,974,126	D387G	probably benign	Het
Phc1	A	G	6: 122,335,031	F56S	probably damaging	Het
Pik3c2g	A	G	6: 139,622,063	E59G	possibly damaging	Het
Prickle1	G	T	15: 93,500,871	T692K	possibly damaging	Het
Rbm45	T	A	2: 76,376,394	L250Q	probably damaging	Het
Ror1	T	A	4: 100,407,911	M194K	probably damaging	Het
Rrbp1	T	A	2: 143,957,802		probably null	Het
Rundc3b	T	C	5: 8,512,348	K340R	probably null	Het
Scn1a	T	A	2: 66,317,899	T1101S	probably damaging	Het
Sdk1	C	G	5: 142,094,657		probably null	Het
Skiv2l	A	G	17: 34,845,207	F501S	possibly damaging	Het
Slc20a1	T	A	2: 129,200,059	M114K	probably damaging	Het
Sorl1	A	C	9: 41,969,751	I2158S	probably benign	Het
Strip1	A	T	3: 107,626,795	F174L	probably benign	Het
Sucnr1	A	T	3: 60,086,278	I76L	probably benign	Het
Syt17	C	T	7: 118,408,019	V412I	probably benign	Het
Tie1	T	A	4: 118,489,653	H18L	probably benign	Het
Tpp1	T	G	7: 105,748,922	K345Q	probably damaging	Het
Trcg1	G	A	9: 57,241,569	M141I	possibly damaging	Het
Trpc4ap	T	C	2: 155,657,822	N260S	probably benign	Het
Vps52	A	T	17: 33,959,319	M147L	probably benign	Het
Ywhaq	A	G	12: 21,391,751		probably benign	Het
Zfp619	A	G	7: 39,534,963	N139S	probably benign	Het

Other mutations in Vps41

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01134:Vps41	APN	13	18866150	missense	probably benign	0.37
IGL01563:Vps41	APN	13	18782727	splice site	probably benign
IGL01880:Vps41	APN	13	18810471	missense	probably benign	0.01
IGL02024:Vps41	APN	13	18791657	splice site	probably benign
IGL02458:Vps41	APN	13	18853479	missense	possibly damaging	0.67
IGL02740:Vps41	APN	13	18838680	missense	probably damaging	1.00
IGL03218:Vps41	APN	13	18829270	missense	possibly damaging	0.74
R0197:Vps41	UTSW	13	18854663	critical splice donor site	probably null
R0284:Vps41	UTSW	13	18853440	missense	probably damaging	1.00
R0321:Vps41	UTSW	13	18842295	splice site	probably benign
R0372:Vps41	UTSW	13	18842247	missense	probably benign	0.00
R0382:Vps41	UTSW	13	18827727	missense	probably benign	0.30
R1691:Vps41	UTSW	13	18841243	missense	probably damaging	1.00
R2055:Vps41	UTSW	13	18854616	missense	possibly damaging	0.95
R2082:Vps41	UTSW	13	18852351	missense	probably benign	0.27
R2147:Vps41	UTSW	13	18839734	splice site	probably null
R2897:Vps41	UTSW	13	18810428	splice site	probably benign
R4322:Vps41	UTSW	13	18823790	missense	probably damaging	1.00
R4600:Vps41	UTSW	13	18745283	missense	probably damaging	0.97
R4751:Vps41	UTSW	13	18811622	missense	probably damaging	0.98
R4856:Vps41	UTSW	13	18829255	missense	probably damaging	0.98
R5389:Vps41	UTSW	13	18862538	missense	probably damaging	0.99
R7456:Vps41	UTSW	13	18864034	missense	probably benign	0.02
R7747:Vps41	UTSW	13	18841252	critical splice donor site	probably null
R7790:Vps41	UTSW	13	18842268	missense	possibly damaging	0.76
R8029:Vps41	UTSW	13	18823785	nonsense	probably null
R8033:Vps41	UTSW	13	18810465	missense	possibly damaging	0.94
R8241:Vps41	UTSW	13	18848998	missense	possibly damaging	0.73
R8267:Vps41	UTSW	13	18810471	missense	probably benign	0.00
Z1177:Vps41	UTSW	13	18845935	missense	probably benign	0.00
Z1177:Vps41	UTSW	13	18854595	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CTTTAATGGCCTGCACTGGG -3'
(R):5'- ACACCATTCCTCTGGCAGAC -3'

Sequencing Primer
(F):5'- GCAGATTGAAACCCAGCTGTG -3'
(R):5'- TGGCAGACAGATCTCACTATAATGC -3'

Posted On

2019-05-13