Mutagenetix > Incidental Mutation

Incidental Mutation 'R7023:Asxl1'

545741

Institutional Source

Beutler Lab

Gene Symbol

Asxl1

Ensembl Gene

ENSMUSG00000042548

Gene Name

additional sex combs like 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7023 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

153345829-153404007 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 153400549 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1006 (D1006E)

Ref Sequence

ENSEMBL: ENSMUSP00000154224 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109790] [ENSMUST00000227428]

AlphaFold

P59598

Predicted Effect

probably benign
Transcript: ENSMUST00000109790
AA Change: D1007E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000105413
Gene: ENSMUSG00000042548
AA Change: D1007E

Domain	Start	End	E-Value	Type
Pfam:HARE-HTH	11	83	1.6e-20	PFAM
low complexity region	199	209	N/A	INTRINSIC
Pfam:ASXH	236	361	5.9e-40	PFAM
low complexity region	411	422	N/A	INTRINSIC
low complexity region	639	667	N/A	INTRINSIC
low complexity region	705	716	N/A	INTRINSIC
low complexity region	848	860	N/A	INTRINSIC
low complexity region	986	1000	N/A	INTRINSIC
Pfam:PHD_3	1446	1512	6.3e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000227428
AA Change: D1006E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Disruption of this gene causes alterations in lymphocyte development in adult mice. Mice homozygous for a different knock-out allele exhibit complete lethality. Mice heterozygous for this allele exhibit eye opacity and abnormal vertebrae morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	A	G	13: 119,473,907	H372R	probably benign	Het
4933405O20Rik	T	C	7: 50,600,253	I345T	probably damaging	Het
4933427D14Rik	A	G	11: 72,178,403		probably null	Het
6430548M08Rik	T	C	8: 120,145,357	V8A	probably damaging	Het
9530053A07Rik	T	A	7: 28,140,038	C425*	probably null	Het
Adam2	A	T	14: 66,043,056	D501E	probably benign	Het
Agbl3	T	C	6: 34,814,769	V602A	probably benign	Het
Akap12	T	C	10: 4,356,895	M1235T	probably benign	Het
Arid5a	G	A	1: 36,317,550		probably benign	Het
AY074887	T	C	9: 54,950,865		probably benign	Het
Btbd9	T	A	17: 30,527,572	R93S	probably benign	Het
Cabp2	A	T	19: 4,082,658		probably null	Het
Cacna1e	T	C	1: 154,725,693	D76G	probably null	Het
Cd177	A	G	7: 24,759,762	I74T	probably benign	Het
Chchd1	G	A	14: 20,703,242		probably benign	Het
Col28a1	T	C	6: 8,083,763	R565G	possibly damaging	Het
Cpvl	T	A	6: 53,967,812	I80F	probably benign	Het
Csgalnact1	T	C	8: 68,358,429	T530A	probably benign	Het
Cybrd1	A	G	2: 71,138,578	D265G	probably benign	Het
Cyp2c69	A	T	19: 39,877,542	N202K	probably benign	Het
D1Pas1	A	G	1: 186,968,008	N45D	probably damaging	Het
Dclre1a	A	G	19: 56,540,206	V839A	probably damaging	Het
Degs1	A	T	1: 182,279,065	Y210N	probably damaging	Het
Doc2g	A	G	19: 4,004,778	S220G	probably benign	Het
Epb41l2	T	A	10: 25,512,977	L885Q	probably damaging	Het
Fabp1	A	T	6: 71,203,085		probably null	Het
Fat2	G	A	11: 55,310,502	S582L	probably benign	Het
Fras1	A	G	5: 96,710,084	N2079S	probably benign	Het
Gdf6	T	C	4: 9,860,210	Y431H	probably damaging	Het
Gfra1	A	T	19: 58,454,332	L6Q	probably damaging	Het
Gm45861	T	G	8: 27,581,006	S1305A	unknown	Het
Gse1	T	C	8: 120,230,648		probably benign	Het
Kmt2e	A	G	5: 23,500,487	H1303R	possibly damaging	Het
Lck	T	C	4: 129,548,865	D499G	possibly damaging	Het
Lepr	A	T	4: 101,789,287	Y805F	probably damaging	Het
Lin7a	A	T	10: 107,382,628	Y11F	possibly damaging	Het
Lrrc43	A	G	5: 123,503,763	K559E	probably damaging	Het
Megf6	T	C	4: 154,254,145	L467P	possibly damaging	Het
Mprip	G	A	11: 59,737,389	G221R	probably damaging	Het
Myo5c	T	C	9: 75,301,456	V1683A	probably damaging	Het
Nbeal2	G	A	9: 110,638,618	R501W	probably damaging	Het
Ncf1	G	T	5: 134,225,262	A219E	possibly damaging	Het
Nckap1l	T	C	15: 103,476,066	I616T	probably benign	Het
Nlrp2	A	T	7: 5,328,229	C389*	probably null	Het
Nrg3	T	C	14: 38,376,376	E507G	probably damaging	Het
Olfr1180	A	G	2: 88,412,415	L81P	probably damaging	Het
P4ha2	A	T	11: 54,131,246	T532S	probably benign	Het
Pappa	A	T	4: 65,351,718	H1623L	probably benign	Het
Paqr6	A	G	3: 88,366,046	Y115C	probably damaging	Het
Pcolce2	A	T	9: 95,678,468	Q190L	probably benign	Het
Poll	A	G	19: 45,558,838	I65T	probably benign	Het
Prmt9	T	C	8: 77,549,457		probably benign	Het
Prpf39	T	C	12: 65,053,300	V130A	possibly damaging	Het
Prpf6	A	G	2: 181,620,640	D144G	probably damaging	Het
Rgs6	T	A	12: 83,092,104		probably benign	Het
Rimbp2	A	G	5: 128,802,783		probably null	Het
Ripor2	A	G	13: 24,671,846	T90A	probably benign	Het
Rnf150	T	C	8: 82,864,077	F23S	probably damaging	Het
Rpp40	G	A	13: 35,898,906	R200W	possibly damaging	Het
Rtp3	G	A	9: 110,986,646	S217L	probably benign	Het
Sacs	A	C	14: 61,208,815	K2770T	probably benign	Het
Scn10a	A	T	9: 119,613,544	I1545N	probably damaging	Het
Scn2b	G	T	9: 45,126,140	V162L	probably damaging	Het
Sema6d	A	G	2: 124,664,911	T880A	probably damaging	Het
Slc36a4	A	G	9: 15,719,633	D16G	probably benign	Het
Slc4a8	T	A	15: 100,791,643	I378K	probably benign	Het
Smco2	T	A	6: 146,858,856	L70*	probably null	Het
Sptb	C	T	12: 76,625,088	V364I	probably damaging	Het
Susd4	A	G	1: 182,765,048	H3R	probably damaging	Het
Tbc1d16	T	C	11: 119,158,791	Q293R	probably damaging	Het
Tnfsf9	T	A	17: 57,107,317	M248K	possibly damaging	Het
Toporsl	A	G	4: 52,611,211	N368S	possibly damaging	Het
Trip11	T	C	12: 101,885,867	E361G	probably benign	Het
Trrap	T	A	5: 144,792,154	M626K	possibly damaging	Het
Ttn	A	T	2: 76,942,874	S2395T	probably damaging	Het
Ubqln3	T	C	7: 104,141,423	R487G	probably damaging	Het
Vdac1	A	G	11: 52,374,366	Y22C	probably damaging	Het
Vmn1r59	C	T	7: 5,454,478	M94I	probably benign	Het
Vmn2r10	G	T	5: 109,002,028	D383E	probably damaging	Het
Vmn2r115	T	C	17: 23,359,811	Y753H	probably damaging	Het
Vmn2r97	G	T	17: 18,914,401	C27F	probably damaging	Het
Wasf1	T	A	10: 40,936,475	V420E	unknown	Het
Zfp94	A	T	7: 24,303,396	L201Q	probably damaging	Het
Zgpat	TGGAGGAGGAGGAGGAGGA	TGGAGGAGGAGGAGGA	2: 181,366,018		probably benign	Het
Zmym4	C	A	4: 126,868,800	R1410L	probably damaging	Het

Other mutations in Asxl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01409:Asxl1	APN	2	153392940	splice site	probably benign
IGL01432:Asxl1	APN	2	153400205	missense	probably benign	0.38
IGL01543:Asxl1	APN	2	153401484	missense	probably benign	0.11
IGL02355:Asxl1	APN	2	153401786	missense	probably benign	0.34
IGL02362:Asxl1	APN	2	153401786	missense	probably benign	0.34
IGL02645:Asxl1	APN	2	153392857	missense	possibly damaging	0.94
IGL02696:Asxl1	APN	2	153400195	nonsense	probably null
IGL03365:Asxl1	APN	2	153401754	missense	probably damaging	1.00
IGL03372:Asxl1	APN	2	153400413	missense	probably damaging	0.99
IGL03377:Asxl1	APN	2	153396780	missense	probably damaging	1.00
astrophel	UTSW	2	153400106	missense	possibly damaging	0.75
hairbrush	UTSW	2	153400724	missense	possibly damaging	0.55
R0044:Asxl1	UTSW	2	153400209	missense	probably benign	0.06
R0044:Asxl1	UTSW	2	153400209	missense	probably benign	0.06
R0600:Asxl1	UTSW	2	153399904	missense	probably benign	0.00
R0659:Asxl1	UTSW	2	153400724	missense	possibly damaging	0.55
R0661:Asxl1	UTSW	2	153400724	missense	possibly damaging	0.55
R0684:Asxl1	UTSW	2	153397522	missense	probably damaging	1.00
R1606:Asxl1	UTSW	2	153400455	missense	probably damaging	0.99
R1747:Asxl1	UTSW	2	153393454	missense	possibly damaging	0.86
R1796:Asxl1	UTSW	2	153401606	missense	probably benign	0.31
R1914:Asxl1	UTSW	2	153401906	missense	probably damaging	1.00
R2099:Asxl1	UTSW	2	153352267	missense	possibly damaging	0.95
R2373:Asxl1	UTSW	2	153401900	missense	probably benign	0.13
R2910:Asxl1	UTSW	2	153401039	missense	probably benign	0.00
R3620:Asxl1	UTSW	2	153357155	missense	probably damaging	1.00
R3701:Asxl1	UTSW	2	153399344	missense	probably benign	0.04
R4200:Asxl1	UTSW	2	153400106	missense	possibly damaging	0.75
R4773:Asxl1	UTSW	2	153401985	missense	probably damaging	1.00
R4902:Asxl1	UTSW	2	153399831	missense	probably benign	0.02
R5100:Asxl1	UTSW	2	153397931	missense	probably damaging	1.00
R5102:Asxl1	UTSW	2	153400955	missense	probably benign	0.00
R5166:Asxl1	UTSW	2	153401121	missense	probably damaging	1.00
R5421:Asxl1	UTSW	2	153399584	missense	probably benign	0.04
R5701:Asxl1	UTSW	2	153399489	missense	probably damaging	1.00
R5861:Asxl1	UTSW	2	153399390	missense	probably damaging	0.99
R5973:Asxl1	UTSW	2	153402011	missense	probably damaging	0.97
R6384:Asxl1	UTSW	2	153391824	critical splice donor site	probably null
R7028:Asxl1	UTSW	2	153400107	missense	probably benign	0.00
R7176:Asxl1	UTSW	2	153401988	missense	probably damaging	1.00
R7297:Asxl1	UTSW	2	153397435	missense	probably benign	0.01
R7378:Asxl1	UTSW	2	153401993	missense	probably damaging	1.00
R7464:Asxl1	UTSW	2	153397785	missense	probably benign	0.01
R7678:Asxl1	UTSW	2	153400652	missense	probably damaging	1.00
R7686:Asxl1	UTSW	2	153391614	missense	probably damaging	1.00
R7789:Asxl1	UTSW	2	153400023	missense	probably benign	0.00
R7838:Asxl1	UTSW	2	153396813	missense	probably damaging	1.00
R7898:Asxl1	UTSW	2	153399934	missense	possibly damaging	0.65
R8281:Asxl1	UTSW	2	153399401	missense	probably damaging	1.00
R8354:Asxl1	UTSW	2	153393425	missense	probably benign	0.40
R8383:Asxl1	UTSW	2	153393719	missense	probably damaging	1.00
R8995:Asxl1	UTSW	2	153393966	missense	probably damaging	1.00
R9183:Asxl1	UTSW	2	153397920	missense	probably damaging	0.99
X0024:Asxl1	UTSW	2	153401985	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGAGAGCTGCATTTCACATTG -3'
(R):5'- TGGCACTCAGTACTGGACAG -3'

Sequencing Primer
(F):5'- GAGAGCTGCATTTCACATTGGACAC -3'
(R):5'- TCAGTACTGGACAGCAACAG -3'

Posted On

2019-05-13