Incidental Mutation 'R7023:Asxl1'
ID545741
Institutional Source Beutler Lab
Gene Symbol Asxl1
Ensembl Gene ENSMUSG00000042548
Gene Nameadditional sex combs like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7023 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location153345829-153404007 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 153400549 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1006 (D1006E)
Ref Sequence ENSEMBL: ENSMUSP00000154224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109790] [ENSMUST00000227428]
Predicted Effect probably benign
Transcript: ENSMUST00000109790
AA Change: D1007E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105413
Gene: ENSMUSG00000042548
AA Change: D1007E

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.6e-20 PFAM
low complexity region 199 209 N/A INTRINSIC
Pfam:ASXH 236 361 5.9e-40 PFAM
low complexity region 411 422 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
low complexity region 705 716 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
Pfam:PHD_3 1446 1512 6.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227428
AA Change: D1006E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Disruption of this gene causes alterations in lymphocyte development in adult mice. Mice homozygous for a different knock-out allele exhibit complete lethality. Mice heterozygous for this allele exhibit eye opacity and abnormal vertebrae morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,473,907 H372R probably benign Het
4933405O20Rik T C 7: 50,600,253 I345T probably damaging Het
4933427D14Rik A G 11: 72,178,403 probably null Het
6430548M08Rik T C 8: 120,145,357 V8A probably damaging Het
9530053A07Rik T A 7: 28,140,038 C425* probably null Het
Adam2 A T 14: 66,043,056 D501E probably benign Het
Agbl3 T C 6: 34,814,769 V602A probably benign Het
Akap12 T C 10: 4,356,895 M1235T probably benign Het
Arid5a G A 1: 36,317,550 probably benign Het
AY074887 T C 9: 54,950,865 probably benign Het
Btbd9 T A 17: 30,527,572 R93S probably benign Het
Cabp2 A T 19: 4,082,658 probably null Het
Cacna1e T C 1: 154,725,693 D76G probably null Het
Cd177 A G 7: 24,759,762 I74T probably benign Het
Chchd1 G A 14: 20,703,242 probably benign Het
Col28a1 T C 6: 8,083,763 R565G possibly damaging Het
Cpvl T A 6: 53,967,812 I80F probably benign Het
Csgalnact1 T C 8: 68,358,429 T530A probably benign Het
Cybrd1 A G 2: 71,138,578 D265G probably benign Het
Cyp2c69 A T 19: 39,877,542 N202K probably benign Het
D1Pas1 A G 1: 186,968,008 N45D probably damaging Het
Dclre1a A G 19: 56,540,206 V839A probably damaging Het
Degs1 A T 1: 182,279,065 Y210N probably damaging Het
Doc2g A G 19: 4,004,778 S220G probably benign Het
Epb41l2 T A 10: 25,512,977 L885Q probably damaging Het
Fabp1 A T 6: 71,203,085 probably null Het
Fat2 G A 11: 55,310,502 S582L probably benign Het
Fras1 A G 5: 96,710,084 N2079S probably benign Het
Gdf6 T C 4: 9,860,210 Y431H probably damaging Het
Gfra1 A T 19: 58,454,332 L6Q probably damaging Het
Gm45861 T G 8: 27,581,006 S1305A unknown Het
Gse1 T C 8: 120,230,648 probably benign Het
Kmt2e A G 5: 23,500,487 H1303R possibly damaging Het
Lck T C 4: 129,548,865 D499G possibly damaging Het
Lepr A T 4: 101,789,287 Y805F probably damaging Het
Lin7a A T 10: 107,382,628 Y11F possibly damaging Het
Lrrc43 A G 5: 123,503,763 K559E probably damaging Het
Megf6 T C 4: 154,254,145 L467P possibly damaging Het
Mprip G A 11: 59,737,389 G221R probably damaging Het
Myo5c T C 9: 75,301,456 V1683A probably damaging Het
Nbeal2 G A 9: 110,638,618 R501W probably damaging Het
Ncf1 G T 5: 134,225,262 A219E possibly damaging Het
Nckap1l T C 15: 103,476,066 I616T probably benign Het
Nlrp2 A T 7: 5,328,229 C389* probably null Het
Nrg3 T C 14: 38,376,376 E507G probably damaging Het
Olfr1180 A G 2: 88,412,415 L81P probably damaging Het
P4ha2 A T 11: 54,131,246 T532S probably benign Het
Pappa A T 4: 65,351,718 H1623L probably benign Het
Paqr6 A G 3: 88,366,046 Y115C probably damaging Het
Pcolce2 A T 9: 95,678,468 Q190L probably benign Het
Poll A G 19: 45,558,838 I65T probably benign Het
Prmt9 T C 8: 77,549,457 probably benign Het
Prpf39 T C 12: 65,053,300 V130A possibly damaging Het
Prpf6 A G 2: 181,620,640 D144G probably damaging Het
Rgs6 T A 12: 83,092,104 probably benign Het
Rimbp2 A G 5: 128,802,783 probably null Het
Ripor2 A G 13: 24,671,846 T90A probably benign Het
Rnf150 T C 8: 82,864,077 F23S probably damaging Het
Rpp40 G A 13: 35,898,906 R200W possibly damaging Het
Rtp3 G A 9: 110,986,646 S217L probably benign Het
Sacs A C 14: 61,208,815 K2770T probably benign Het
Scn10a A T 9: 119,613,544 I1545N probably damaging Het
Scn2b G T 9: 45,126,140 V162L probably damaging Het
Sema6d A G 2: 124,664,911 T880A probably damaging Het
Slc36a4 A G 9: 15,719,633 D16G probably benign Het
Slc4a8 T A 15: 100,791,643 I378K probably benign Het
Smco2 T A 6: 146,858,856 L70* probably null Het
Sptb C T 12: 76,625,088 V364I probably damaging Het
Susd4 A G 1: 182,765,048 H3R probably damaging Het
Tbc1d16 T C 11: 119,158,791 Q293R probably damaging Het
Tnfsf9 T A 17: 57,107,317 M248K possibly damaging Het
Toporsl A G 4: 52,611,211 N368S possibly damaging Het
Trip11 T C 12: 101,885,867 E361G probably benign Het
Trrap T A 5: 144,792,154 M626K possibly damaging Het
Ttn A T 2: 76,942,874 S2395T probably damaging Het
Ubqln3 T C 7: 104,141,423 R487G probably damaging Het
Vdac1 A G 11: 52,374,366 Y22C probably damaging Het
Vmn1r59 C T 7: 5,454,478 M94I probably benign Het
Vmn2r10 G T 5: 109,002,028 D383E probably damaging Het
Vmn2r115 T C 17: 23,359,811 Y753H probably damaging Het
Vmn2r97 G T 17: 18,914,401 C27F probably damaging Het
Wasf1 T A 10: 40,936,475 V420E unknown Het
Zfp94 A T 7: 24,303,396 L201Q probably damaging Het
Zgpat TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 2: 181,366,018 probably benign Het
Zmym4 C A 4: 126,868,800 R1410L probably damaging Het
Other mutations in Asxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Asxl1 APN 2 153392940 splice site probably benign
IGL01432:Asxl1 APN 2 153400205 missense probably benign 0.38
IGL01543:Asxl1 APN 2 153401484 missense probably benign 0.11
IGL02355:Asxl1 APN 2 153401786 missense probably benign 0.34
IGL02362:Asxl1 APN 2 153401786 missense probably benign 0.34
IGL02645:Asxl1 APN 2 153392857 missense possibly damaging 0.94
IGL02696:Asxl1 APN 2 153400195 nonsense probably null
IGL03365:Asxl1 APN 2 153401754 missense probably damaging 1.00
IGL03372:Asxl1 APN 2 153400413 missense probably damaging 0.99
IGL03377:Asxl1 APN 2 153396780 missense probably damaging 1.00
astrophel UTSW 2 153400106 missense possibly damaging 0.75
hairbrush UTSW 2 153400724 missense possibly damaging 0.55
R0044:Asxl1 UTSW 2 153400209 missense probably benign 0.06
R0044:Asxl1 UTSW 2 153400209 missense probably benign 0.06
R0600:Asxl1 UTSW 2 153399904 missense probably benign 0.00
R0659:Asxl1 UTSW 2 153400724 missense possibly damaging 0.55
R0661:Asxl1 UTSW 2 153400724 missense possibly damaging 0.55
R0684:Asxl1 UTSW 2 153397522 missense probably damaging 1.00
R1606:Asxl1 UTSW 2 153400455 missense probably damaging 0.99
R1747:Asxl1 UTSW 2 153393454 missense possibly damaging 0.86
R1796:Asxl1 UTSW 2 153401606 missense probably benign 0.31
R1914:Asxl1 UTSW 2 153401906 missense probably damaging 1.00
R2099:Asxl1 UTSW 2 153352267 missense possibly damaging 0.95
R2373:Asxl1 UTSW 2 153401900 missense probably benign 0.13
R2910:Asxl1 UTSW 2 153401039 missense probably benign 0.00
R3620:Asxl1 UTSW 2 153357155 missense probably damaging 1.00
R3701:Asxl1 UTSW 2 153399344 missense probably benign 0.04
R4200:Asxl1 UTSW 2 153400106 missense possibly damaging 0.75
R4773:Asxl1 UTSW 2 153401985 missense probably damaging 1.00
R4902:Asxl1 UTSW 2 153399831 missense probably benign 0.02
R5100:Asxl1 UTSW 2 153397931 missense probably damaging 1.00
R5102:Asxl1 UTSW 2 153400955 missense probably benign 0.00
R5166:Asxl1 UTSW 2 153401121 missense probably damaging 1.00
R5421:Asxl1 UTSW 2 153399584 missense probably benign 0.04
R5701:Asxl1 UTSW 2 153399489 missense probably damaging 1.00
R5861:Asxl1 UTSW 2 153399390 missense probably damaging 0.99
R5973:Asxl1 UTSW 2 153402011 missense probably damaging 0.97
R6384:Asxl1 UTSW 2 153391824 critical splice donor site probably null
R7028:Asxl1 UTSW 2 153400107 missense probably benign 0.00
R7176:Asxl1 UTSW 2 153401988 missense probably damaging 1.00
R7297:Asxl1 UTSW 2 153397435 missense probably benign 0.01
R7378:Asxl1 UTSW 2 153401993 missense probably damaging 1.00
R7464:Asxl1 UTSW 2 153397785 missense probably benign 0.01
R7678:Asxl1 UTSW 2 153400652 missense probably damaging 1.00
R7686:Asxl1 UTSW 2 153391614 missense probably damaging 1.00
R7789:Asxl1 UTSW 2 153400023 missense probably benign 0.00
R7838:Asxl1 UTSW 2 153396813 missense probably damaging 1.00
R7898:Asxl1 UTSW 2 153399934 missense possibly damaging 0.65
R8281:Asxl1 UTSW 2 153399401 missense probably damaging 1.00
R8354:Asxl1 UTSW 2 153393425 missense probably benign 0.40
R8383:Asxl1 UTSW 2 153393719 missense probably damaging 1.00
X0024:Asxl1 UTSW 2 153401985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGAGAGCTGCATTTCACATTG -3'
(R):5'- TGGCACTCAGTACTGGACAG -3'

Sequencing Primer
(F):5'- GAGAGCTGCATTTCACATTGGACAC -3'
(R):5'- TCAGTACTGGACAGCAACAG -3'
Posted On2019-05-13