Mutagenetix > Incidental Mutation

Incidental Mutation 'R7023:Lepr'

545748

Institutional Source

Beutler Lab

Gene Symbol

Lepr

Ensembl Gene

ENSMUSG00000057722

Gene Name

leptin receptor

Synonyms

obl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7023 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101717404-101815352 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101789287 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 805 (Y805F)

Ref Sequence

ENSEMBL: ENSMUSP00000102534 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000102777] [ENSMUST00000106921]

AlphaFold

P48356

Predicted Effect

probably damaging
Transcript: ENSMUST00000037552
AA Change: Y805F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: Y805F

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	328	418	6.3e-23	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC
low complexity region	908	921	N/A	INTRINSIC
low complexity region	1050	1065	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102777
AA Change: Y805F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722
AA Change: Y805F

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	329	420	2.6e-29	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106921
AA Change: Y805F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722
AA Change: Y805F

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
FN3	236	315	1.5e-5	SMART
Pfam:Lep_receptor_Ig	329	420	2.6e-29	PFAM
FN3	535	618	4.93e-1	SMART
FN3	641	721	3.25e1	SMART
FN3	736	818	2.35e0	SMART
transmembrane domain	838	860	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	A	G	13: 119,473,907	H372R	probably benign	Het
4933405O20Rik	T	C	7: 50,600,253	I345T	probably damaging	Het
4933427D14Rik	A	G	11: 72,178,403		probably null	Het
6430548M08Rik	T	C	8: 120,145,357	V8A	probably damaging	Het
9530053A07Rik	T	A	7: 28,140,038	C425*	probably null	Het
Adam2	A	T	14: 66,043,056	D501E	probably benign	Het
Agbl3	T	C	6: 34,814,769	V602A	probably benign	Het
Akap12	T	C	10: 4,356,895	M1235T	probably benign	Het
Arid5a	G	A	1: 36,317,550		probably benign	Het
Asxl1	T	A	2: 153,400,549	D1006E	probably benign	Het
AY074887	T	C	9: 54,950,865		probably benign	Het
Btbd9	T	A	17: 30,527,572	R93S	probably benign	Het
Cabp2	A	T	19: 4,082,658		probably null	Het
Cacna1e	T	C	1: 154,725,693	D76G	probably null	Het
Cd177	A	G	7: 24,759,762	I74T	probably benign	Het
Chchd1	G	A	14: 20,703,242		probably benign	Het
Col28a1	T	C	6: 8,083,763	R565G	possibly damaging	Het
Cpvl	T	A	6: 53,967,812	I80F	probably benign	Het
Csgalnact1	T	C	8: 68,358,429	T530A	probably benign	Het
Cybrd1	A	G	2: 71,138,578	D265G	probably benign	Het
Cyp2c69	A	T	19: 39,877,542	N202K	probably benign	Het
D1Pas1	A	G	1: 186,968,008	N45D	probably damaging	Het
Dclre1a	A	G	19: 56,540,206	V839A	probably damaging	Het
Degs1	A	T	1: 182,279,065	Y210N	probably damaging	Het
Doc2g	A	G	19: 4,004,778	S220G	probably benign	Het
Epb41l2	T	A	10: 25,512,977	L885Q	probably damaging	Het
Fabp1	A	T	6: 71,203,085		probably null	Het
Fat2	G	A	11: 55,310,502	S582L	probably benign	Het
Fras1	A	G	5: 96,710,084	N2079S	probably benign	Het
Gdf6	T	C	4: 9,860,210	Y431H	probably damaging	Het
Gfra1	A	T	19: 58,454,332	L6Q	probably damaging	Het
Gm45861	T	G	8: 27,581,006	S1305A	unknown	Het
Gse1	T	C	8: 120,230,648		probably benign	Het
Kmt2e	A	G	5: 23,500,487	H1303R	possibly damaging	Het
Lck	T	C	4: 129,548,865	D499G	possibly damaging	Het
Lin7a	A	T	10: 107,382,628	Y11F	possibly damaging	Het
Lrrc43	A	G	5: 123,503,763	K559E	probably damaging	Het
Megf6	T	C	4: 154,254,145	L467P	possibly damaging	Het
Mprip	G	A	11: 59,737,389	G221R	probably damaging	Het
Myo5c	T	C	9: 75,301,456	V1683A	probably damaging	Het
Nbeal2	G	A	9: 110,638,618	R501W	probably damaging	Het
Ncf1	G	T	5: 134,225,262	A219E	possibly damaging	Het
Nckap1l	T	C	15: 103,476,066	I616T	probably benign	Het
Nlrp2	A	T	7: 5,328,229	C389*	probably null	Het
Nrg3	T	C	14: 38,376,376	E507G	probably damaging	Het
Olfr1180	A	G	2: 88,412,415	L81P	probably damaging	Het
P4ha2	A	T	11: 54,131,246	T532S	probably benign	Het
Pappa	A	T	4: 65,351,718	H1623L	probably benign	Het
Paqr6	A	G	3: 88,366,046	Y115C	probably damaging	Het
Pcolce2	A	T	9: 95,678,468	Q190L	probably benign	Het
Poll	A	G	19: 45,558,838	I65T	probably benign	Het
Prmt9	T	C	8: 77,549,457		probably benign	Het
Prpf39	T	C	12: 65,053,300	V130A	possibly damaging	Het
Prpf6	A	G	2: 181,620,640	D144G	probably damaging	Het
Rgs6	T	A	12: 83,092,104		probably benign	Het
Rimbp2	A	G	5: 128,802,783		probably null	Het
Ripor2	A	G	13: 24,671,846	T90A	probably benign	Het
Rnf150	T	C	8: 82,864,077	F23S	probably damaging	Het
Rpp40	G	A	13: 35,898,906	R200W	possibly damaging	Het
Rtp3	G	A	9: 110,986,646	S217L	probably benign	Het
Sacs	A	C	14: 61,208,815	K2770T	probably benign	Het
Scn10a	A	T	9: 119,613,544	I1545N	probably damaging	Het
Scn2b	G	T	9: 45,126,140	V162L	probably damaging	Het
Sema6d	A	G	2: 124,664,911	T880A	probably damaging	Het
Slc36a4	A	G	9: 15,719,633	D16G	probably benign	Het
Slc4a8	T	A	15: 100,791,643	I378K	probably benign	Het
Smco2	T	A	6: 146,858,856	L70*	probably null	Het
Sptb	C	T	12: 76,625,088	V364I	probably damaging	Het
Susd4	A	G	1: 182,765,048	H3R	probably damaging	Het
Tbc1d16	T	C	11: 119,158,791	Q293R	probably damaging	Het
Tnfsf9	T	A	17: 57,107,317	M248K	possibly damaging	Het
Toporsl	A	G	4: 52,611,211	N368S	possibly damaging	Het
Trip11	T	C	12: 101,885,867	E361G	probably benign	Het
Trrap	T	A	5: 144,792,154	M626K	possibly damaging	Het
Ttn	A	T	2: 76,942,874	S2395T	probably damaging	Het
Ubqln3	T	C	7: 104,141,423	R487G	probably damaging	Het
Vdac1	A	G	11: 52,374,366	Y22C	probably damaging	Het
Vmn1r59	C	T	7: 5,454,478	M94I	probably benign	Het
Vmn2r10	G	T	5: 109,002,028	D383E	probably damaging	Het
Vmn2r115	T	C	17: 23,359,811	Y753H	probably damaging	Het
Vmn2r97	G	T	17: 18,914,401	C27F	probably damaging	Het
Wasf1	T	A	10: 40,936,475	V420E	unknown	Het
Zfp94	A	T	7: 24,303,396	L201Q	probably damaging	Het
Zgpat	TGGAGGAGGAGGAGGAGGA	TGGAGGAGGAGGAGGA	2: 181,366,018		probably benign	Het
Zmym4	C	A	4: 126,868,800	R1410L	probably damaging	Het

Other mutations in Lepr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Lepr	APN	4	101815035	missense	probably benign
IGL01111:Lepr	APN	4	101814655	missense	possibly damaging	0.77
IGL01324:Lepr	APN	4	101768068	missense	probably benign	0.23
IGL01372:Lepr	APN	4	101735577	missense	possibly damaging	0.67
IGL01626:Lepr	APN	4	101733534	missense	probably benign	0.10
IGL01733:Lepr	APN	4	101765082	missense	probably benign	0.00
IGL01815:Lepr	APN	4	101814790	missense	possibly damaging	0.49
IGL01899:Lepr	APN	4	101779987	missense	possibly damaging	0.86
IGL02138:Lepr	APN	4	101768067	missense	probably damaging	0.98
IGL02161:Lepr	APN	4	101745678	missense	probably damaging	0.97
IGL02653:Lepr	APN	4	101764944	missense	probably benign	0.44
IGL02735:Lepr	APN	4	101782638	missense	probably damaging	1.00
IGL03035:Lepr	APN	4	101764980	missense	probably damaging	1.00
IGL03083:Lepr	APN	4	101814679	nonsense	probably null
IGL03160:Lepr	APN	4	101764906	missense	probably damaging	1.00
aufsetzigen	UTSW	4	101752175	missense	probably damaging	1.00
business_class	UTSW	4	101764872	missense	probably damaging	1.00
cherub	UTSW	4	101768063	missense	probably benign	0.25
clodhopper	UTSW	4	101765290	splice site	probably null
donner	UTSW	4	101815201	missense	probably damaging	1.00
fluffy	UTSW	4	101792023	missense	probably damaging	1.00
giant	UTSW	4	101765152	critical splice donor site	probably null
gordo	UTSW	4	101765305	missense	probably damaging	0.97
Immunoglutton	UTSW	4	101765301	splice site	probably benign
Jumbo_shrimp	UTSW	4	101764954	nonsense	probably null
lowleaning	UTSW	4	101814391	splice site	probably null
odd	UTSW	4	101728075	splice site	probably benign
paleo	UTSW	4	101745645	missense	possibly damaging	0.94
R0140_Lepr_245	UTSW	4	101768067	missense	probably damaging	1.00
well-upholstered	UTSW	4	101772959	synonymous	probably benign
worldly	UTSW	4	101768228	missense	possibly damaging	0.96
PIT4651001:Lepr	UTSW	4	101791997	missense	probably damaging	1.00
PIT4696001:Lepr	UTSW	4	101779983	missense	probably benign	0.10
R0140:Lepr	UTSW	4	101768067	missense	probably damaging	1.00
R0197:Lepr	UTSW	4	101752152	missense	possibly damaging	0.64
R0279:Lepr	UTSW	4	101750344	missense	probably benign	0.05
R0487:Lepr	UTSW	4	101768093	nonsense	probably null
R0498:Lepr	UTSW	4	101745692	missense	probably benign	0.01
R0506:Lepr	UTSW	4	101773010	splice site	probably benign
R0512:Lepr	UTSW	4	101792019	missense	probably damaging	1.00
R0512:Lepr	UTSW	4	101814704	missense	possibly damaging	0.87
R0726:Lepr	UTSW	4	101764934	missense	probably benign	0.01
R1054:Lepr	UTSW	4	101782596	missense	probably damaging	0.97
R1109:Lepr	UTSW	4	101771355	missense	probably damaging	1.00
R1398:Lepr	UTSW	4	101792019	missense	probably damaging	1.00
R1464:Lepr	UTSW	4	101735681	missense	probably benign	0.08
R1464:Lepr	UTSW	4	101735681	missense	probably benign	0.08
R1519:Lepr	UTSW	4	101789344	missense	probably damaging	0.97
R1602:Lepr	UTSW	4	101745645	missense	possibly damaging	0.94
R1830:Lepr	UTSW	4	101735677	missense	probably damaging	1.00
R1850:Lepr	UTSW	4	101733423	missense	possibly damaging	0.67
R1918:Lepr	UTSW	4	101772836	missense	probably benign	0.08
R1928:Lepr	UTSW	4	101782730	splice site	probably benign
R2099:Lepr	UTSW	4	101772988	missense	probably damaging	1.00
R2102:Lepr	UTSW	4	101772981	missense	possibly damaging	0.95
R2175:Lepr	UTSW	4	101765379	missense	probably benign	0.01
R2254:Lepr	UTSW	4	101815112	missense	probably benign	0.26
R2396:Lepr	UTSW	4	101733528	missense	probably benign	0.19
R2508:Lepr	UTSW	4	101790896	missense	probably damaging	0.98
R2571:Lepr	UTSW	4	101768172	missense	possibly damaging	0.96
R3790:Lepr	UTSW	4	101790914	splice site	probably benign
R3882:Lepr	UTSW	4	101815265	missense	probably damaging	1.00
R3933:Lepr	UTSW	4	101765301	splice site	probably benign
R4211:Lepr	UTSW	4	101733414	missense	probably benign	0.19
R4343:Lepr	UTSW	4	101765152	critical splice donor site	probably null
R4345:Lepr	UTSW	4	101765152	critical splice donor site	probably null
R4544:Lepr	UTSW	4	101768228	missense	possibly damaging	0.96
R4546:Lepr	UTSW	4	101814641	missense	probably benign	0.35
R4724:Lepr	UTSW	4	101765365	nonsense	probably null
R4797:Lepr	UTSW	4	101780047	missense	possibly damaging	0.90
R4860:Lepr	UTSW	4	101789337	missense	probably benign	0.14
R4860:Lepr	UTSW	4	101789337	missense	probably benign	0.14
R4929:Lepr	UTSW	4	101815117	missense	probably benign	0.00
R4939:Lepr	UTSW	4	101733438	missense	possibly damaging	0.78
R5377:Lepr	UTSW	4	101815019	missense	possibly damaging	0.71
R5520:Lepr	UTSW	4	101745537	missense	probably benign	0.00
R5966:Lepr	UTSW	4	101792127	intron	probably benign
R6092:Lepr	UTSW	4	101792023	missense	probably damaging	1.00
R6130:Lepr	UTSW	4	101765372	missense	probably damaging	0.99
R6168:Lepr	UTSW	4	101735592	missense	probably damaging	0.99
R6232:Lepr	UTSW	4	101814391	splice site	probably null
R6380:Lepr	UTSW	4	101764954	nonsense	probably null
R6427:Lepr	UTSW	4	101774257	missense	possibly damaging	0.47
R6428:Lepr	UTSW	4	101780098	missense	probably damaging	1.00
R6641:Lepr	UTSW	4	101765305	missense	probably damaging	0.97
R6650:Lepr	UTSW	4	101815201	missense	probably damaging	1.00
R6859:Lepr	UTSW	4	101765290	splice site	probably null
R7145:Lepr	UTSW	4	101752197	missense	probably benign	0.00
R7174:Lepr	UTSW	4	101750338	missense	probably benign	0.01
R7179:Lepr	UTSW	4	101745659	missense	probably benign	0.06
R7189:Lepr	UTSW	4	101814764	missense	probably benign	0.00
R7426:Lepr	UTSW	4	101745656	missense	probably benign	0.03
R7531:Lepr	UTSW	4	101752175	missense	probably damaging	1.00
R7620:Lepr	UTSW	4	101752073	missense	probably benign	0.41
R7804:Lepr	UTSW	4	101782586	missense	probably damaging	1.00
R8022:Lepr	UTSW	4	101782557	missense	probably benign	0.32
R8142:Lepr	UTSW	4	101765419	missense	possibly damaging	0.93
R8227:Lepr	UTSW	4	101771362	missense	probably damaging	0.99
R8426:Lepr	UTSW	4	101814644	missense	probably benign	0.12
R8447:Lepr	UTSW	4	101814491	missense	probably benign	0.08
R8531:Lepr	UTSW	4	101765415	missense	probably damaging	1.00
R8682:Lepr	UTSW	4	101792072	missense	probably benign	0.00
R8897:Lepr	UTSW	4	101792036	missense	probably damaging	0.98
R9096:Lepr	UTSW	4	101774221	missense	possibly damaging	0.95
R9177:Lepr	UTSW	4	101745601	nonsense	probably null
R9241:Lepr	UTSW	4	101814591	missense	probably benign
X0026:Lepr	UTSW	4	101733327	missense	possibly damaging	0.47
Z1176:Lepr	UTSW	4	101745614	missense	probably damaging	0.99
Z1177:Lepr	UTSW	4	101735595	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGAGTTGCCTTGGTCATGG -3'
(R):5'- GACAAGCCTTGGAGTATACAGTG -3'

Sequencing Primer
(F):5'- GTCATGGTGTCTCTTCATAACAATGG -3'
(R):5'- TTTACCTTTGGTGAAACCAT -3'

Posted On

2019-05-13