Incidental Mutation 'R7023:Lepr'
ID545748
Institutional Source Beutler Lab
Gene Symbol Lepr
Ensembl Gene ENSMUSG00000057722
Gene Nameleptin receptor
Synonymsobl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7023 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location101717404-101815352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101789287 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 805 (Y805F)
Ref Sequence ENSEMBL: ENSMUSP00000102534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037552] [ENSMUST00000102777] [ENSMUST00000106921]
Predicted Effect probably damaging
Transcript: ENSMUST00000037552
AA Change: Y805F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722
AA Change: Y805F

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 328 418 6.3e-23 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
low complexity region 908 921 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102777
AA Change: Y805F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722
AA Change: Y805F

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106921
AA Change: Y805F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722
AA Change: Y805F

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,473,907 H372R probably benign Het
4933405O20Rik T C 7: 50,600,253 I345T probably damaging Het
4933427D14Rik A G 11: 72,178,403 probably null Het
6430548M08Rik T C 8: 120,145,357 V8A probably damaging Het
9530053A07Rik T A 7: 28,140,038 C425* probably null Het
Adam2 A T 14: 66,043,056 D501E probably benign Het
Agbl3 T C 6: 34,814,769 V602A probably benign Het
Akap12 T C 10: 4,356,895 M1235T probably benign Het
Arid5a G A 1: 36,317,550 probably benign Het
Asxl1 T A 2: 153,400,549 D1006E probably benign Het
AY074887 T C 9: 54,950,865 probably benign Het
Btbd9 T A 17: 30,527,572 R93S probably benign Het
Cabp2 A T 19: 4,082,658 probably null Het
Cacna1e T C 1: 154,725,693 D76G probably null Het
Cd177 A G 7: 24,759,762 I74T probably benign Het
Chchd1 G A 14: 20,703,242 probably benign Het
Col28a1 T C 6: 8,083,763 R565G possibly damaging Het
Cpvl T A 6: 53,967,812 I80F probably benign Het
Csgalnact1 T C 8: 68,358,429 T530A probably benign Het
Cybrd1 A G 2: 71,138,578 D265G probably benign Het
Cyp2c69 A T 19: 39,877,542 N202K probably benign Het
D1Pas1 A G 1: 186,968,008 N45D probably damaging Het
Dclre1a A G 19: 56,540,206 V839A probably damaging Het
Degs1 A T 1: 182,279,065 Y210N probably damaging Het
Doc2g A G 19: 4,004,778 S220G probably benign Het
Epb41l2 T A 10: 25,512,977 L885Q probably damaging Het
Fabp1 A T 6: 71,203,085 probably null Het
Fat2 G A 11: 55,310,502 S582L probably benign Het
Fras1 A G 5: 96,710,084 N2079S probably benign Het
Gdf6 T C 4: 9,860,210 Y431H probably damaging Het
Gfra1 A T 19: 58,454,332 L6Q probably damaging Het
Gm45861 T G 8: 27,581,006 S1305A unknown Het
Gse1 T C 8: 120,230,648 probably benign Het
Kmt2e A G 5: 23,500,487 H1303R possibly damaging Het
Lck T C 4: 129,548,865 D499G possibly damaging Het
Lin7a A T 10: 107,382,628 Y11F possibly damaging Het
Lrrc43 A G 5: 123,503,763 K559E probably damaging Het
Megf6 T C 4: 154,254,145 L467P possibly damaging Het
Mprip G A 11: 59,737,389 G221R probably damaging Het
Myo5c T C 9: 75,301,456 V1683A probably damaging Het
Nbeal2 G A 9: 110,638,618 R501W probably damaging Het
Ncf1 G T 5: 134,225,262 A219E possibly damaging Het
Nckap1l T C 15: 103,476,066 I616T probably benign Het
Nlrp2 A T 7: 5,328,229 C389* probably null Het
Nrg3 T C 14: 38,376,376 E507G probably damaging Het
Olfr1180 A G 2: 88,412,415 L81P probably damaging Het
P4ha2 A T 11: 54,131,246 T532S probably benign Het
Pappa A T 4: 65,351,718 H1623L probably benign Het
Paqr6 A G 3: 88,366,046 Y115C probably damaging Het
Pcolce2 A T 9: 95,678,468 Q190L probably benign Het
Poll A G 19: 45,558,838 I65T probably benign Het
Prmt9 T C 8: 77,549,457 probably benign Het
Prpf39 T C 12: 65,053,300 V130A possibly damaging Het
Prpf6 A G 2: 181,620,640 D144G probably damaging Het
Rgs6 T A 12: 83,092,104 probably benign Het
Rimbp2 A G 5: 128,802,783 probably null Het
Ripor2 A G 13: 24,671,846 T90A probably benign Het
Rnf150 T C 8: 82,864,077 F23S probably damaging Het
Rpp40 G A 13: 35,898,906 R200W possibly damaging Het
Rtp3 G A 9: 110,986,646 S217L probably benign Het
Sacs A C 14: 61,208,815 K2770T probably benign Het
Scn10a A T 9: 119,613,544 I1545N probably damaging Het
Scn2b G T 9: 45,126,140 V162L probably damaging Het
Sema6d A G 2: 124,664,911 T880A probably damaging Het
Slc36a4 A G 9: 15,719,633 D16G probably benign Het
Slc4a8 T A 15: 100,791,643 I378K probably benign Het
Smco2 T A 6: 146,858,856 L70* probably null Het
Sptb C T 12: 76,625,088 V364I probably damaging Het
Susd4 A G 1: 182,765,048 H3R probably damaging Het
Tbc1d16 T C 11: 119,158,791 Q293R probably damaging Het
Tnfsf9 T A 17: 57,107,317 M248K possibly damaging Het
Toporsl A G 4: 52,611,211 N368S possibly damaging Het
Trip11 T C 12: 101,885,867 E361G probably benign Het
Trrap T A 5: 144,792,154 M626K possibly damaging Het
Ttn A T 2: 76,942,874 S2395T probably damaging Het
Ubqln3 T C 7: 104,141,423 R487G probably damaging Het
Vdac1 A G 11: 52,374,366 Y22C probably damaging Het
Vmn1r59 C T 7: 5,454,478 M94I probably benign Het
Vmn2r10 G T 5: 109,002,028 D383E probably damaging Het
Vmn2r115 T C 17: 23,359,811 Y753H probably damaging Het
Vmn2r97 G T 17: 18,914,401 C27F probably damaging Het
Wasf1 T A 10: 40,936,475 V420E unknown Het
Zfp94 A T 7: 24,303,396 L201Q probably damaging Het
Zgpat TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 2: 181,366,018 probably benign Het
Zmym4 C A 4: 126,868,800 R1410L probably damaging Het
Other mutations in Lepr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lepr APN 4 101815035 missense probably benign
IGL01111:Lepr APN 4 101814655 missense possibly damaging 0.77
IGL01324:Lepr APN 4 101768068 missense probably benign 0.23
IGL01372:Lepr APN 4 101735577 missense possibly damaging 0.67
IGL01626:Lepr APN 4 101733534 missense probably benign 0.10
IGL01733:Lepr APN 4 101765082 missense probably benign 0.00
IGL01815:Lepr APN 4 101814790 missense possibly damaging 0.49
IGL01899:Lepr APN 4 101779987 missense possibly damaging 0.86
IGL02138:Lepr APN 4 101768067 missense probably damaging 0.98
IGL02161:Lepr APN 4 101745678 missense probably damaging 0.97
IGL02653:Lepr APN 4 101764944 missense probably benign 0.44
IGL02735:Lepr APN 4 101782638 missense probably damaging 1.00
IGL03035:Lepr APN 4 101764980 missense probably damaging 1.00
IGL03083:Lepr APN 4 101814679 nonsense probably null
IGL03160:Lepr APN 4 101764906 missense probably damaging 1.00
aufsetzigen UTSW 4 101752175 missense probably damaging 1.00
business_class UTSW 4 101764872 missense probably damaging 1.00
cherub UTSW 4 101768063 missense probably benign 0.25
clodhopper UTSW 4 101765290 splice site probably null
donner UTSW 4 101815201 missense probably damaging 1.00
fluffy UTSW 4 101792023 missense probably damaging 1.00
giant UTSW 4 101765152 critical splice donor site probably null
gordo UTSW 4 101765305 missense probably damaging 0.97
Immunoglutton UTSW 4 101765301 splice site probably benign
Jumbo_shrimp UTSW 4 101764954 nonsense probably null
lowleaning UTSW 4 101814391 splice site probably null
odd UTSW 4 101728075 splice site probably benign
paleo UTSW 4 101745645 missense possibly damaging 0.94
well-upholstered UTSW 4 101772959 synonymous probably benign
worldly UTSW 4 101768228 missense possibly damaging 0.96
PIT4651001:Lepr UTSW 4 101791997 missense probably damaging 1.00
PIT4696001:Lepr UTSW 4 101779983 missense probably benign 0.10
R0140:Lepr UTSW 4 101768067 missense probably damaging 1.00
R0197:Lepr UTSW 4 101752152 missense possibly damaging 0.64
R0279:Lepr UTSW 4 101750344 missense probably benign 0.05
R0487:Lepr UTSW 4 101768093 nonsense probably null
R0498:Lepr UTSW 4 101745692 missense probably benign 0.01
R0506:Lepr UTSW 4 101773010 splice site probably benign
R0512:Lepr UTSW 4 101792019 missense probably damaging 1.00
R0512:Lepr UTSW 4 101814704 missense possibly damaging 0.87
R0726:Lepr UTSW 4 101764934 missense probably benign 0.01
R1054:Lepr UTSW 4 101782596 missense probably damaging 0.97
R1109:Lepr UTSW 4 101771355 missense probably damaging 1.00
R1398:Lepr UTSW 4 101792019 missense probably damaging 1.00
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1519:Lepr UTSW 4 101789344 missense probably damaging 0.97
R1602:Lepr UTSW 4 101745645 missense possibly damaging 0.94
R1830:Lepr UTSW 4 101735677 missense probably damaging 1.00
R1850:Lepr UTSW 4 101733423 missense possibly damaging 0.67
R1918:Lepr UTSW 4 101772836 missense probably benign 0.08
R1928:Lepr UTSW 4 101782730 splice site probably benign
R2099:Lepr UTSW 4 101772988 missense probably damaging 1.00
R2102:Lepr UTSW 4 101772981 missense possibly damaging 0.95
R2175:Lepr UTSW 4 101765379 missense probably benign 0.01
R2254:Lepr UTSW 4 101815112 missense probably benign 0.26
R2396:Lepr UTSW 4 101733528 missense probably benign 0.19
R2508:Lepr UTSW 4 101790896 missense probably damaging 0.98
R2571:Lepr UTSW 4 101768172 missense possibly damaging 0.96
R3790:Lepr UTSW 4 101790914 splice site probably benign
R3882:Lepr UTSW 4 101815265 missense probably damaging 1.00
R3933:Lepr UTSW 4 101765301 splice site probably benign
R4211:Lepr UTSW 4 101733414 missense probably benign 0.19
R4343:Lepr UTSW 4 101765152 critical splice donor site probably null
R4345:Lepr UTSW 4 101765152 critical splice donor site probably null
R4544:Lepr UTSW 4 101768228 missense possibly damaging 0.96
R4546:Lepr UTSW 4 101814641 missense probably benign 0.35
R4724:Lepr UTSW 4 101765365 nonsense probably null
R4797:Lepr UTSW 4 101780047 missense possibly damaging 0.90
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4929:Lepr UTSW 4 101815117 missense probably benign 0.00
R4939:Lepr UTSW 4 101733438 missense possibly damaging 0.78
R5377:Lepr UTSW 4 101815019 missense possibly damaging 0.71
R5520:Lepr UTSW 4 101745537 missense probably benign 0.00
R5966:Lepr UTSW 4 101792127 intron probably benign
R6092:Lepr UTSW 4 101792023 missense probably damaging 1.00
R6130:Lepr UTSW 4 101765372 missense probably damaging 0.99
R6168:Lepr UTSW 4 101735592 missense probably damaging 0.99
R6232:Lepr UTSW 4 101814391 splice site probably null
R6380:Lepr UTSW 4 101764954 nonsense probably null
R6427:Lepr UTSW 4 101774257 missense possibly damaging 0.47
R6428:Lepr UTSW 4 101780098 missense probably damaging 1.00
R6641:Lepr UTSW 4 101765305 missense probably damaging 0.97
R6650:Lepr UTSW 4 101815201 missense probably damaging 1.00
R6859:Lepr UTSW 4 101765290 splice site probably null
R7145:Lepr UTSW 4 101752197 missense probably benign 0.00
R7174:Lepr UTSW 4 101750338 missense probably benign 0.01
R7179:Lepr UTSW 4 101745659 missense probably benign 0.06
R7189:Lepr UTSW 4 101814764 missense probably benign 0.00
R7426:Lepr UTSW 4 101745656 missense probably benign 0.03
R7531:Lepr UTSW 4 101752175 missense probably damaging 1.00
R7620:Lepr UTSW 4 101752073 missense probably benign 0.41
R7804:Lepr UTSW 4 101782586 missense probably damaging 1.00
R8022:Lepr UTSW 4 101782557 missense probably benign 0.32
R8142:Lepr UTSW 4 101765419 missense possibly damaging 0.93
R8227:Lepr UTSW 4 101771362 missense probably damaging 0.99
R8426:Lepr UTSW 4 101814644 missense probably benign 0.12
R8447:Lepr UTSW 4 101814491 missense probably benign 0.08
X0026:Lepr UTSW 4 101733327 missense possibly damaging 0.47
Z1176:Lepr UTSW 4 101745614 missense probably damaging 0.99
Z1177:Lepr UTSW 4 101735595 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGTTGCCTTGGTCATGG -3'
(R):5'- GACAAGCCTTGGAGTATACAGTG -3'

Sequencing Primer
(F):5'- GTCATGGTGTCTCTTCATAACAATGG -3'
(R):5'- TTTACCTTTGGTGAAACCAT -3'
Posted On2019-05-13