Incidental Mutation 'R7023:Vmn2r10'
ID 545754
Institutional Source Beutler Lab
Gene Symbol Vmn2r10
Ensembl Gene ENSMUSG00000067010
Gene Name vomeronasal 2, receptor 10
Synonyms V2r16, VR16
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R7023 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 108993412-109006471 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 109002028 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 383 (D383E)
Ref Sequence ENSEMBL: ENSMUSP00000078162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079163] [ENSMUST00000176594]
AlphaFold K7N621
Predicted Effect probably damaging
Transcript: ENSMUST00000079163
AA Change: D383E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078162
Gene: ENSMUSG00000067010
AA Change: D383E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 8.5e-29 PFAM
Pfam:NCD3G 506 560 3.8e-17 PFAM
Pfam:7tm_3 593 828 4e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176594
SMART Domains Protein: ENSMUSP00000135274
Gene: ENSMUSG00000067010

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,473,907 H372R probably benign Het
4933405O20Rik T C 7: 50,600,253 I345T probably damaging Het
4933427D14Rik A G 11: 72,178,403 probably null Het
6430548M08Rik T C 8: 120,145,357 V8A probably damaging Het
9530053A07Rik T A 7: 28,140,038 C425* probably null Het
Adam2 A T 14: 66,043,056 D501E probably benign Het
Agbl3 T C 6: 34,814,769 V602A probably benign Het
Akap12 T C 10: 4,356,895 M1235T probably benign Het
Arid5a G A 1: 36,317,550 probably benign Het
Asxl1 T A 2: 153,400,549 D1006E probably benign Het
AY074887 T C 9: 54,950,865 probably benign Het
Btbd9 T A 17: 30,527,572 R93S probably benign Het
Cabp2 A T 19: 4,082,658 probably null Het
Cacna1e T C 1: 154,725,693 D76G probably null Het
Cd177 A G 7: 24,759,762 I74T probably benign Het
Chchd1 G A 14: 20,703,242 probably benign Het
Col28a1 T C 6: 8,083,763 R565G possibly damaging Het
Cpvl T A 6: 53,967,812 I80F probably benign Het
Csgalnact1 T C 8: 68,358,429 T530A probably benign Het
Cybrd1 A G 2: 71,138,578 D265G probably benign Het
Cyp2c69 A T 19: 39,877,542 N202K probably benign Het
D1Pas1 A G 1: 186,968,008 N45D probably damaging Het
Dclre1a A G 19: 56,540,206 V839A probably damaging Het
Degs1 A T 1: 182,279,065 Y210N probably damaging Het
Doc2g A G 19: 4,004,778 S220G probably benign Het
Epb41l2 T A 10: 25,512,977 L885Q probably damaging Het
Fabp1 A T 6: 71,203,085 probably null Het
Fat2 G A 11: 55,310,502 S582L probably benign Het
Fras1 A G 5: 96,710,084 N2079S probably benign Het
Gdf6 T C 4: 9,860,210 Y431H probably damaging Het
Gfra1 A T 19: 58,454,332 L6Q probably damaging Het
Gm45861 T G 8: 27,581,006 S1305A unknown Het
Gse1 T C 8: 120,230,648 probably benign Het
Kmt2e A G 5: 23,500,487 H1303R possibly damaging Het
Lck T C 4: 129,548,865 D499G possibly damaging Het
Lepr A T 4: 101,789,287 Y805F probably damaging Het
Lin7a A T 10: 107,382,628 Y11F possibly damaging Het
Lrrc43 A G 5: 123,503,763 K559E probably damaging Het
Megf6 T C 4: 154,254,145 L467P possibly damaging Het
Mprip G A 11: 59,737,389 G221R probably damaging Het
Myo5c T C 9: 75,301,456 V1683A probably damaging Het
Nbeal2 G A 9: 110,638,618 R501W probably damaging Het
Ncf1 G T 5: 134,225,262 A219E possibly damaging Het
Nckap1l T C 15: 103,476,066 I616T probably benign Het
Nlrp2 A T 7: 5,328,229 C389* probably null Het
Nrg3 T C 14: 38,376,376 E507G probably damaging Het
Olfr1180 A G 2: 88,412,415 L81P probably damaging Het
P4ha2 A T 11: 54,131,246 T532S probably benign Het
Pappa A T 4: 65,351,718 H1623L probably benign Het
Paqr6 A G 3: 88,366,046 Y115C probably damaging Het
Pcolce2 A T 9: 95,678,468 Q190L probably benign Het
Poll A G 19: 45,558,838 I65T probably benign Het
Prmt9 T C 8: 77,549,457 probably benign Het
Prpf39 T C 12: 65,053,300 V130A possibly damaging Het
Prpf6 A G 2: 181,620,640 D144G probably damaging Het
Rgs6 T A 12: 83,092,104 probably benign Het
Rimbp2 A G 5: 128,802,783 probably null Het
Ripor2 A G 13: 24,671,846 T90A probably benign Het
Rnf150 T C 8: 82,864,077 F23S probably damaging Het
Rpp40 G A 13: 35,898,906 R200W possibly damaging Het
Rtp3 G A 9: 110,986,646 S217L probably benign Het
Sacs A C 14: 61,208,815 K2770T probably benign Het
Scn10a A T 9: 119,613,544 I1545N probably damaging Het
Scn2b G T 9: 45,126,140 V162L probably damaging Het
Sema6d A G 2: 124,664,911 T880A probably damaging Het
Slc36a4 A G 9: 15,719,633 D16G probably benign Het
Slc4a8 T A 15: 100,791,643 I378K probably benign Het
Smco2 T A 6: 146,858,856 L70* probably null Het
Sptb C T 12: 76,625,088 V364I probably damaging Het
Susd4 A G 1: 182,765,048 H3R probably damaging Het
Tbc1d16 T C 11: 119,158,791 Q293R probably damaging Het
Tnfsf9 T A 17: 57,107,317 M248K possibly damaging Het
Toporsl A G 4: 52,611,211 N368S possibly damaging Het
Trip11 T C 12: 101,885,867 E361G probably benign Het
Trrap T A 5: 144,792,154 M626K possibly damaging Het
Ttn A T 2: 76,942,874 S2395T probably damaging Het
Ubqln3 T C 7: 104,141,423 R487G probably damaging Het
Vdac1 A G 11: 52,374,366 Y22C probably damaging Het
Vmn1r59 C T 7: 5,454,478 M94I probably benign Het
Vmn2r115 T C 17: 23,359,811 Y753H probably damaging Het
Vmn2r97 G T 17: 18,914,401 C27F probably damaging Het
Wasf1 T A 10: 40,936,475 V420E unknown Het
Zfp94 A T 7: 24,303,396 L201Q probably damaging Het
Zgpat TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 2: 181,366,018 probably benign Het
Zmym4 C A 4: 126,868,800 R1410L probably damaging Het
Other mutations in Vmn2r10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Vmn2r10 APN 5 109002585 missense possibly damaging 0.75
IGL01618:Vmn2r10 APN 5 109002479 missense probably damaging 1.00
IGL01624:Vmn2r10 APN 5 109006246 missense possibly damaging 0.83
IGL01941:Vmn2r10 APN 5 108995954 missense probably damaging 1.00
IGL01959:Vmn2r10 APN 5 108997705 missense probably benign 0.00
IGL01973:Vmn2r10 APN 5 108995677 missense probably damaging 1.00
IGL01985:Vmn2r10 APN 5 109006259 missense probably benign 0.21
IGL02451:Vmn2r10 APN 5 108995922 nonsense probably null
IGL02503:Vmn2r10 APN 5 109003475 missense probably damaging 1.00
IGL03275:Vmn2r10 APN 5 109003377 missense probably benign 0.00
R0035:Vmn2r10 UTSW 5 108997601 splice site probably benign
R0395:Vmn2r10 UTSW 5 109001993 missense probably damaging 1.00
R0454:Vmn2r10 UTSW 5 109003461 missense probably benign 0.25
R0648:Vmn2r10 UTSW 5 108995916 missense probably benign 0.00
R1251:Vmn2r10 UTSW 5 108996024 missense probably benign 0.01
R1580:Vmn2r10 UTSW 5 109006251 missense possibly damaging 0.82
R1845:Vmn2r10 UTSW 5 109001995 nonsense probably null
R1986:Vmn2r10 UTSW 5 109006254 nonsense probably null
R2137:Vmn2r10 UTSW 5 109003544 missense possibly damaging 0.87
R2495:Vmn2r10 UTSW 5 108996095 missense probably damaging 1.00
R3932:Vmn2r10 UTSW 5 109002222 missense possibly damaging 0.47
R3933:Vmn2r10 UTSW 5 109002222 missense possibly damaging 0.47
R4899:Vmn2r10 UTSW 5 109003458 missense probably damaging 1.00
R4992:Vmn2r10 UTSW 5 108997726 missense possibly damaging 0.89
R5124:Vmn2r10 UTSW 5 109006420 missense probably benign 0.01
R5145:Vmn2r10 UTSW 5 108995895 missense possibly damaging 0.64
R5156:Vmn2r10 UTSW 5 108995600 missense probably benign 0.11
R5265:Vmn2r10 UTSW 5 108995720 missense probably damaging 1.00
R5311:Vmn2r10 UTSW 5 109006255 missense probably damaging 1.00
R5321:Vmn2r10 UTSW 5 108995639 missense probably damaging 1.00
R5666:Vmn2r10 UTSW 5 108999044 nonsense probably null
R5670:Vmn2r10 UTSW 5 108999044 nonsense probably null
R5872:Vmn2r10 UTSW 5 109003511 missense possibly damaging 0.84
R6004:Vmn2r10 UTSW 5 108999078 missense probably benign 0.30
R6108:Vmn2r10 UTSW 5 108995801 missense probably damaging 1.00
R6332:Vmn2r10 UTSW 5 109003462 missense probably damaging 1.00
R6599:Vmn2r10 UTSW 5 108996078 missense probably benign 0.09
R6651:Vmn2r10 UTSW 5 108995622 missense probably null 0.22
R6891:Vmn2r10 UTSW 5 109001979 missense probably damaging 1.00
R7146:Vmn2r10 UTSW 5 109003334 missense probably damaging 1.00
R7941:Vmn2r10 UTSW 5 108996440 missense probably damaging 1.00
R8058:Vmn2r10 UTSW 5 109002089 missense probably benign 0.00
R8478:Vmn2r10 UTSW 5 108995770 missense probably damaging 1.00
R8526:Vmn2r10 UTSW 5 108997706 missense possibly damaging 0.51
R8698:Vmn2r10 UTSW 5 109003524 missense probably benign 0.00
R8796:Vmn2r10 UTSW 5 108996051 missense possibly damaging 0.74
R8854:Vmn2r10 UTSW 5 108996260 missense probably benign 0.20
R8871:Vmn2r10 UTSW 5 108999033 missense possibly damaging 0.67
R8893:Vmn2r10 UTSW 5 108995811 missense probably benign 0.09
R8907:Vmn2r10 UTSW 5 109001925 missense probably benign
R8957:Vmn2r10 UTSW 5 109001914 missense possibly damaging 0.60
R8976:Vmn2r10 UTSW 5 108997613 missense probably damaging 1.00
R9155:Vmn2r10 UTSW 5 108996346 missense probably benign 0.10
R9308:Vmn2r10 UTSW 5 108997610 nonsense probably null
Z1088:Vmn2r10 UTSW 5 108996113 missense probably damaging 1.00
Z1176:Vmn2r10 UTSW 5 109001988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGGGGACTTTAGGGATAGCATTG -3'
(R):5'- GGACTGTCACTTTTGCACACC -3'

Sequencing Primer
(F):5'- GGACTTTAGGGATAGCATTGAAATG -3'
(R):5'- GTCACTTTTGCACACCATGTAGG -3'
Posted On 2019-05-13