Mutagenetix > Incidental Mutation

Incidental Mutation 'R7023:Agbl3'

545760

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

045124-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7023 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34814769 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 602 (V602A)

Ref Sequence

ENSEMBL: ENSMUSP00000110668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably benign
Transcript: ENSMUST00000115016
AA Change: V602A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: V602A

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115017
AA Change: V597A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: V597A

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	A	G	13: 119,473,907	H372R	probably benign	Het
4933405O20Rik	T	C	7: 50,600,253	I345T	probably damaging	Het
4933427D14Rik	A	G	11: 72,178,403		probably null	Het
6430548M08Rik	T	C	8: 120,145,357	V8A	probably damaging	Het
9530053A07Rik	T	A	7: 28,140,038	C425*	probably null	Het
Adam2	A	T	14: 66,043,056	D501E	probably benign	Het
Akap12	T	C	10: 4,356,895	M1235T	probably benign	Het
Arid5a	G	A	1: 36,317,550		probably benign	Het
Asxl1	T	A	2: 153,400,549	D1006E	probably benign	Het
AY074887	T	C	9: 54,950,865		probably benign	Het
Btbd9	T	A	17: 30,527,572	R93S	probably benign	Het
Cabp2	A	T	19: 4,082,658		probably null	Het
Cacna1e	T	C	1: 154,725,693	D76G	probably null	Het
Cd177	A	G	7: 24,759,762	I74T	probably benign	Het
Chchd1	G	A	14: 20,703,242		probably benign	Het
Col28a1	T	C	6: 8,083,763	R565G	possibly damaging	Het
Cpvl	T	A	6: 53,967,812	I80F	probably benign	Het
Csgalnact1	T	C	8: 68,358,429	T530A	probably benign	Het
Cybrd1	A	G	2: 71,138,578	D265G	probably benign	Het
Cyp2c69	A	T	19: 39,877,542	N202K	probably benign	Het
D1Pas1	A	G	1: 186,968,008	N45D	probably damaging	Het
Dclre1a	A	G	19: 56,540,206	V839A	probably damaging	Het
Degs1	A	T	1: 182,279,065	Y210N	probably damaging	Het
Doc2g	A	G	19: 4,004,778	S220G	probably benign	Het
Epb41l2	T	A	10: 25,512,977	L885Q	probably damaging	Het
Fabp1	A	T	6: 71,203,085		probably null	Het
Fat2	G	A	11: 55,310,502	S582L	probably benign	Het
Fras1	A	G	5: 96,710,084	N2079S	probably benign	Het
Gdf6	T	C	4: 9,860,210	Y431H	probably damaging	Het
Gfra1	A	T	19: 58,454,332	L6Q	probably damaging	Het
Gm45861	T	G	8: 27,581,006	S1305A	unknown	Het
Gse1	T	C	8: 120,230,648		probably benign	Het
Kmt2e	A	G	5: 23,500,487	H1303R	possibly damaging	Het
Lck	T	C	4: 129,548,865	D499G	possibly damaging	Het
Lepr	A	T	4: 101,789,287	Y805F	probably damaging	Het
Lin7a	A	T	10: 107,382,628	Y11F	possibly damaging	Het
Lrrc43	A	G	5: 123,503,763	K559E	probably damaging	Het
Megf6	T	C	4: 154,254,145	L467P	possibly damaging	Het
Mprip	G	A	11: 59,737,389	G221R	probably damaging	Het
Myo5c	T	C	9: 75,301,456	V1683A	probably damaging	Het
Nbeal2	G	A	9: 110,638,618	R501W	probably damaging	Het
Ncf1	G	T	5: 134,225,262	A219E	possibly damaging	Het
Nckap1l	T	C	15: 103,476,066	I616T	probably benign	Het
Nlrp2	A	T	7: 5,328,229	C389*	probably null	Het
Nrg3	T	C	14: 38,376,376	E507G	probably damaging	Het
Olfr1180	A	G	2: 88,412,415	L81P	probably damaging	Het
P4ha2	A	T	11: 54,131,246	T532S	probably benign	Het
Pappa	A	T	4: 65,351,718	H1623L	probably benign	Het
Paqr6	A	G	3: 88,366,046	Y115C	probably damaging	Het
Pcolce2	A	T	9: 95,678,468	Q190L	probably benign	Het
Poll	A	G	19: 45,558,838	I65T	probably benign	Het
Prmt9	T	C	8: 77,549,457		probably benign	Het
Prpf39	T	C	12: 65,053,300	V130A	possibly damaging	Het
Prpf6	A	G	2: 181,620,640	D144G	probably damaging	Het
Rgs6	T	A	12: 83,092,104		probably benign	Het
Rimbp2	A	G	5: 128,802,783		probably null	Het
Ripor2	A	G	13: 24,671,846	T90A	probably benign	Het
Rnf150	T	C	8: 82,864,077	F23S	probably damaging	Het
Rpp40	G	A	13: 35,898,906	R200W	possibly damaging	Het
Rtp3	G	A	9: 110,986,646	S217L	probably benign	Het
Sacs	A	C	14: 61,208,815	K2770T	probably benign	Het
Scn10a	A	T	9: 119,613,544	I1545N	probably damaging	Het
Scn2b	G	T	9: 45,126,140	V162L	probably damaging	Het
Sema6d	A	G	2: 124,664,911	T880A	probably damaging	Het
Slc36a4	A	G	9: 15,719,633	D16G	probably benign	Het
Slc4a8	T	A	15: 100,791,643	I378K	probably benign	Het
Smco2	T	A	6: 146,858,856	L70*	probably null	Het
Sptb	C	T	12: 76,625,088	V364I	probably damaging	Het
Susd4	A	G	1: 182,765,048	H3R	probably damaging	Het
Tbc1d16	T	C	11: 119,158,791	Q293R	probably damaging	Het
Tnfsf9	T	A	17: 57,107,317	M248K	possibly damaging	Het
Toporsl	A	G	4: 52,611,211	N368S	possibly damaging	Het
Trip11	T	C	12: 101,885,867	E361G	probably benign	Het
Trrap	T	A	5: 144,792,154	M626K	possibly damaging	Het
Ttn	A	T	2: 76,942,874	S2395T	probably damaging	Het
Ubqln3	T	C	7: 104,141,423	R487G	probably damaging	Het
Vdac1	A	G	11: 52,374,366	Y22C	probably damaging	Het
Vmn1r59	C	T	7: 5,454,478	M94I	probably benign	Het
Vmn2r10	G	T	5: 109,002,028	D383E	probably damaging	Het
Vmn2r115	T	C	17: 23,359,811	Y753H	probably damaging	Het
Vmn2r97	G	T	17: 18,914,401	C27F	probably damaging	Het
Wasf1	T	A	10: 40,936,475	V420E	unknown	Het
Zfp94	A	T	7: 24,303,396	L201Q	probably damaging	Het
Zgpat	TGGAGGAGGAGGAGGAGGA	TGGAGGAGGAGGAGGA	2: 181,366,018		probably benign	Het
Zmym4	C	A	4: 126,868,800	R1410L	probably damaging	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAATGGCCTGTCTGCTGTC -3'
(R):5'- TGCACTTGTGAAAACTTTCCC -3'

Sequencing Primer
(F):5'- CAGCAGGTTTCCCGTTTTAATAG -3'
(R):5'- TGTGAAAACTTTCCCTAATATGAGTC -3'

Posted On

2019-05-13