Incidental Mutation 'R7023:Ubqln3'
ID 545770
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
MMRRC Submission 045124-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R7023 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 103789830-103792486 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103790630 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 487 (R487G)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
AlphaFold Q8C5U9
Predicted Effect probably damaging
Transcript: ENSMUST00000057254
AA Change: R487G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: R487G

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,610,443 (GRCm39) H372R probably benign Het
4933405O20Rik T C 7: 50,250,001 (GRCm39) I345T probably damaging Het
4933427D14Rik A G 11: 72,069,229 (GRCm39) probably null Het
6430548M08Rik T C 8: 120,872,096 (GRCm39) V8A probably damaging Het
Adam2 A T 14: 66,280,505 (GRCm39) D501E probably benign Het
Agbl3 T C 6: 34,791,704 (GRCm39) V602A probably benign Het
Akap12 T C 10: 4,306,895 (GRCm39) M1235T probably benign Het
Arid5a G A 1: 36,356,631 (GRCm39) probably benign Het
Asxl1 T A 2: 153,242,469 (GRCm39) D1006E probably benign Het
AY074887 T C 9: 54,858,149 (GRCm39) probably benign Het
Btbd9 T A 17: 30,746,546 (GRCm39) R93S probably benign Het
Cabp2 A T 19: 4,132,658 (GRCm39) probably null Het
Cacna1e T C 1: 154,601,439 (GRCm39) D76G probably null Het
Cd177 A G 7: 24,459,187 (GRCm39) I74T probably benign Het
Chchd1 G A 14: 20,753,310 (GRCm39) probably benign Het
Col28a1 T C 6: 8,083,763 (GRCm39) R565G possibly damaging Het
Cpvl T A 6: 53,944,797 (GRCm39) I80F probably benign Het
Csgalnact1 T C 8: 68,811,081 (GRCm39) T530A probably benign Het
Cybrd1 A G 2: 70,968,922 (GRCm39) D265G probably benign Het
Cyp2c69 A T 19: 39,865,986 (GRCm39) N202K probably benign Het
D1Pas1 A G 1: 186,700,205 (GRCm39) N45D probably damaging Het
Dclre1a A G 19: 56,528,638 (GRCm39) V839A probably damaging Het
Degs1 A T 1: 182,106,630 (GRCm39) Y210N probably damaging Het
Doc2g A G 19: 4,054,778 (GRCm39) S220G probably benign Het
Epb41l2 T A 10: 25,388,875 (GRCm39) L885Q probably damaging Het
Fabp1 A T 6: 71,180,069 (GRCm39) probably null Het
Fat2 G A 11: 55,201,328 (GRCm39) S582L probably benign Het
Fcgbpl1 T A 7: 27,839,463 (GRCm39) C425* probably null Het
Fras1 A G 5: 96,857,943 (GRCm39) N2079S probably benign Het
Gdf6 T C 4: 9,860,210 (GRCm39) Y431H probably damaging Het
Gfra1 A T 19: 58,442,764 (GRCm39) L6Q probably damaging Het
Gm45861 T G 8: 28,071,034 (GRCm39) S1305A unknown Het
Gse1 T C 8: 120,957,387 (GRCm39) probably benign Het
Kmt2e A G 5: 23,705,485 (GRCm39) H1303R possibly damaging Het
Lck T C 4: 129,442,658 (GRCm39) D499G possibly damaging Het
Lepr A T 4: 101,646,484 (GRCm39) Y805F probably damaging Het
Lin7a A T 10: 107,218,489 (GRCm39) Y11F possibly damaging Het
Lrrc43 A G 5: 123,641,826 (GRCm39) K559E probably damaging Het
Megf6 T C 4: 154,338,602 (GRCm39) L467P possibly damaging Het
Mprip G A 11: 59,628,215 (GRCm39) G221R probably damaging Het
Myo5c T C 9: 75,208,738 (GRCm39) V1683A probably damaging Het
Nbeal2 G A 9: 110,467,686 (GRCm39) R501W probably damaging Het
Ncf1 G T 5: 134,254,116 (GRCm39) A219E possibly damaging Het
Nckap1l T C 15: 103,384,493 (GRCm39) I616T probably benign Het
Nlrp2 A T 7: 5,331,228 (GRCm39) C389* probably null Het
Nrg3 T C 14: 38,098,333 (GRCm39) E507G probably damaging Het
Or4p19 A G 2: 88,242,759 (GRCm39) L81P probably damaging Het
P4ha2 A T 11: 54,022,072 (GRCm39) T532S probably benign Het
Pappa A T 4: 65,269,955 (GRCm39) H1623L probably benign Het
Paqr6 A G 3: 88,273,353 (GRCm39) Y115C probably damaging Het
Pcolce2 A T 9: 95,560,521 (GRCm39) Q190L probably benign Het
Poll A G 19: 45,547,277 (GRCm39) I65T probably benign Het
Prmt9 T C 8: 78,276,086 (GRCm39) probably benign Het
Prpf39 T C 12: 65,100,074 (GRCm39) V130A possibly damaging Het
Prpf6 A G 2: 181,262,433 (GRCm39) D144G probably damaging Het
Rgs6 T A 12: 83,138,878 (GRCm39) probably benign Het
Rimbp2 A G 5: 128,879,847 (GRCm39) probably null Het
Ripor2 A G 13: 24,855,829 (GRCm39) T90A probably benign Het
Rnf150 T C 8: 83,590,706 (GRCm39) F23S probably damaging Het
Rpp40 G A 13: 36,082,889 (GRCm39) R200W possibly damaging Het
Rtp3 G A 9: 110,815,714 (GRCm39) S217L probably benign Het
Sacs A C 14: 61,446,264 (GRCm39) K2770T probably benign Het
Scn10a A T 9: 119,442,610 (GRCm39) I1545N probably damaging Het
Scn2b G T 9: 45,037,438 (GRCm39) V162L probably damaging Het
Sema6d A G 2: 124,506,831 (GRCm39) T880A probably damaging Het
Slc36a4 A G 9: 15,630,929 (GRCm39) D16G probably benign Het
Slc4a8 T A 15: 100,689,524 (GRCm39) I378K probably benign Het
Smco2 T A 6: 146,760,354 (GRCm39) L70* probably null Het
Sptb C T 12: 76,671,862 (GRCm39) V364I probably damaging Het
Susd4 A G 1: 182,592,613 (GRCm39) H3R probably damaging Het
Tbc1d16 T C 11: 119,049,617 (GRCm39) Q293R probably damaging Het
Tnfsf9 T A 17: 57,414,317 (GRCm39) M248K possibly damaging Het
Toporsl A G 4: 52,611,211 (GRCm39) N368S possibly damaging Het
Trip11 T C 12: 101,852,126 (GRCm39) E361G probably benign Het
Trrap T A 5: 144,728,964 (GRCm39) M626K possibly damaging Het
Ttn A T 2: 76,773,218 (GRCm39) S2395T probably damaging Het
Vdac1 A G 11: 52,265,193 (GRCm39) Y22C probably damaging Het
Vmn1r59 C T 7: 5,457,477 (GRCm39) M94I probably benign Het
Vmn2r10 G T 5: 109,149,894 (GRCm39) D383E probably damaging Het
Vmn2r115 T C 17: 23,578,785 (GRCm39) Y753H probably damaging Het
Vmn2r97 G T 17: 19,134,663 (GRCm39) C27F probably damaging Het
Wasf1 T A 10: 40,812,471 (GRCm39) V420E unknown Het
Zfp94 A T 7: 24,002,821 (GRCm39) L201Q probably damaging Het
Zgpat TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 2: 181,007,811 (GRCm39) probably benign Het
Zmym4 C A 4: 126,762,593 (GRCm39) R1410L probably damaging Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 103,790,984 (GRCm39) missense probably benign 0.00
IGL00766:Ubqln3 APN 7 103,792,031 (GRCm39) missense probably benign 0.00
IGL01451:Ubqln3 APN 7 103,791,403 (GRCm39) missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 103,791,605 (GRCm39) missense probably benign 0.12
IGL01705:Ubqln3 APN 7 103,791,884 (GRCm39) missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 103,792,089 (GRCm39) utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 103,791,523 (GRCm39) missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 103,790,506 (GRCm39) missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 103,791,725 (GRCm39) missense probably benign 0.02
IGL02657:Ubqln3 APN 7 103,791,170 (GRCm39) missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 103,791,272 (GRCm39) missense probably benign 0.19
IGL02709:Ubqln3 APN 7 103,790,543 (GRCm39) missense probably benign 0.12
IGL03357:Ubqln3 APN 7 103,791,763 (GRCm39) missense probably benign
PIT4544001:Ubqln3 UTSW 7 103,790,550 (GRCm39) missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 103,791,047 (GRCm39) missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 103,791,275 (GRCm39) missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 103,790,593 (GRCm39) missense probably benign 0.00
R1280:Ubqln3 UTSW 7 103,791,283 (GRCm39) missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 103,791,997 (GRCm39) missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 103,790,753 (GRCm39) missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 103,792,067 (GRCm39) missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 103,790,228 (GRCm39) missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 103,791,358 (GRCm39) missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 103,791,518 (GRCm39) missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 103,790,842 (GRCm39) nonsense probably null
R2366:Ubqln3 UTSW 7 103,790,256 (GRCm39) missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 103,791,010 (GRCm39) missense probably benign 0.00
R4447:Ubqln3 UTSW 7 103,792,021 (GRCm39) missense probably benign 0.31
R4509:Ubqln3 UTSW 7 103,790,651 (GRCm39) missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 103,791,698 (GRCm39) missense probably benign 0.00
R5416:Ubqln3 UTSW 7 103,790,879 (GRCm39) missense probably benign 0.34
R5617:Ubqln3 UTSW 7 103,791,640 (GRCm39) missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 103,790,117 (GRCm39) missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5723:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5724:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5819:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5820:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5966:Ubqln3 UTSW 7 103,790,906 (GRCm39) missense probably benign 0.03
R6260:Ubqln3 UTSW 7 103,791,524 (GRCm39) nonsense probably null
R6272:Ubqln3 UTSW 7 103,791,385 (GRCm39) missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 103,790,824 (GRCm39) missense probably benign 0.00
R6936:Ubqln3 UTSW 7 103,791,517 (GRCm39) missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 103,790,482 (GRCm39) missense probably benign 0.01
R7079:Ubqln3 UTSW 7 103,790,578 (GRCm39) missense probably benign 0.12
R7733:Ubqln3 UTSW 7 103,790,283 (GRCm39) missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 103,790,443 (GRCm39) missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 103,790,399 (GRCm39) missense probably benign 0.03
R7961:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R8009:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R9619:Ubqln3 UTSW 7 103,791,053 (GRCm39) missense probably benign 0.05
R9652:Ubqln3 UTSW 7 103,791,962 (GRCm39) missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 103,790,385 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCATTCAACCCTGTTAGGCAG -3'
(R):5'- TACTGGACAAGGTGGAAGCC -3'

Sequencing Primer
(F):5'- CTGTTAGGCAGGGCATGAACC -3'
(R):5'- GGTGGAAGCCTACATGATGC -3'
Posted On 2019-05-13