Incidental Mutation 'R0609:Trpm6'
ID54578
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Nametransient receptor potential cation channel, subfamily M, member 6
SynonymsCHAK2
MMRRC Submission 038798-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0609 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location18749983-18892510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18825862 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 890 (I890F)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
Predicted Effect probably damaging
Transcript: ENSMUST00000040489
AA Change: I890F

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: I890F

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik A T 14: 35,811,461 probably null Het
Abcb4 T A 5: 8,947,376 C952S probably damaging Het
Adamtsl2 A G 2: 27,089,635 D272G probably benign Het
Aim2 G A 1: 173,461,964 D158N probably damaging Het
Aldh3b1 C T 19: 3,914,024 R426H probably damaging Het
Apoc2 A G 7: 19,673,353 S28P probably benign Het
Arfgef3 G A 10: 18,597,431 T1628I probably benign Het
Atp10a G A 7: 58,819,740 probably null Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Bmp8b T A 4: 123,121,899 D226E probably benign Het
Brsk2 T C 7: 141,998,492 Y618H probably damaging Het
Casp12 T A 9: 5,346,554 F27Y probably damaging Het
Casp8 T A 1: 58,844,792 N439K probably benign Het
Ccdc175 T A 12: 72,157,507 K253N probably benign Het
Cdc42bpa A G 1: 180,040,179 H193R probably damaging Het
Cdk17 T C 10: 93,216,472 M105T probably benign Het
Cdon C A 9: 35,478,611 P854T probably damaging Het
Cep44 A G 8: 56,544,152 M117T possibly damaging Het
Cep89 A T 7: 35,435,530 E674D probably damaging Het
Cit C T 5: 115,873,943 A203V probably damaging Het
Clstn1 C A 4: 149,629,300 probably null Het
Col7a1 T A 9: 108,958,147 D565E unknown Het
Cpb1 T A 3: 20,262,474 Y304F probably damaging Het
Cps1 T G 1: 67,172,802 Y710D probably damaging Het
Creb3l1 T C 2: 91,987,053 T372A possibly damaging Het
Dars A G 1: 128,405,381 V102A probably benign Het
Dhx35 C T 2: 158,817,415 T168I possibly damaging Het
Dnah5 T C 15: 28,327,779 S2100P probably benign Het
Dst T C 1: 34,266,960 probably null Het
Egflam A C 15: 7,253,523 L351R possibly damaging Het
Elp2 T A 18: 24,626,156 D523E probably benign Het
Exo5 C A 4: 120,921,684 G328V probably damaging Het
Fam208a C T 14: 27,461,750 T722I probably benign Het
Fut9 A G 4: 25,620,811 M1T probably null Het
Galnt5 A G 2: 58,024,625 N584S possibly damaging Het
Gbp3 T C 3: 142,567,772 V360A probably damaging Het
Gdf6 G A 4: 9,859,977 C353Y probably damaging Het
Gm13089 A T 4: 143,698,503 D123E probably benign Het
Hace1 A G 10: 45,648,869 T244A probably damaging Het
Hr T C 14: 70,559,657 I500T probably benign Het
Ifnl2 A T 7: 28,509,282 L115Q probably damaging Het
Iigp1 T C 18: 60,389,824 F5L probably benign Het
Inhbb A G 1: 119,417,416 L381P probably damaging Het
Irx3 A T 8: 91,801,093 S50T probably benign Het
Ivns1abp C T 1: 151,360,145 T363I probably benign Het
Izumo1 A T 7: 45,622,899 T35S probably benign Het
Kank4 A G 4: 98,777,105 S651P probably damaging Het
Kit T C 5: 75,610,879 V232A probably benign Het
Klhl11 T C 11: 100,463,714 Y427C probably damaging Het
Laptm4b T A 15: 34,258,689 N36K probably damaging Het
Lrrk1 T C 7: 66,266,615 probably null Het
Mamdc4 G T 2: 25,564,193 Q1042K probably benign Het
Mical2 A G 7: 112,321,440 probably null Het
Ms4a3 C A 19: 11,631,361 V176F possibly damaging Het
Myo3a T C 2: 22,333,513 V427A probably benign Het
Myo3a A C 2: 22,396,299 E626D possibly damaging Het
Nckap5 A T 1: 126,027,288 L509* probably null Het
Ndufa5 A T 6: 24,519,249 D64E possibly damaging Het
Nedd4l T C 18: 65,208,461 Y753H probably damaging Het
Nynrin T C 14: 55,872,761 V1775A probably damaging Het
Olfr141 A G 2: 86,806,861 L46S probably damaging Het
Olfr292 T C 7: 86,694,876 V140A possibly damaging Het
Olfr694 A T 7: 106,688,998 H244Q probably damaging Het
Olfr735 T C 14: 50,345,926 Y141C probably damaging Het
Olfr823 G A 10: 130,112,580 S70F probably damaging Het
Oplah A G 15: 76,302,992 S570P probably benign Het
Osbpl11 C A 16: 33,234,444 Y632* probably null Het
Osbpl5 A T 7: 143,694,821 L644Q probably damaging Het
Pcdhb19 T C 18: 37,497,952 W267R probably benign Het
Pkhd1l1 A C 15: 44,467,424 S132R possibly damaging Het
Ptpn13 T A 5: 103,556,145 S1348T probably benign Het
Rc3h1 T A 1: 160,930,135 W8R probably damaging Het
Rgs3 T G 4: 62,625,936 V315G probably damaging Het
Rora T A 9: 69,361,869 M82K probably damaging Het
Rph3al T C 11: 75,908,969 I55V probably benign Het
Sag T C 1: 87,812,991 V45A probably damaging Het
Scn3a T C 2: 65,536,510 E56G probably damaging Het
Sec24c T G 14: 20,686,948 V324G probably damaging Het
Sptbn1 A G 11: 30,138,979 L748S probably damaging Het
Stard9 A T 2: 120,706,306 D4186V probably damaging Het
Stk39 T C 2: 68,366,167 E306G probably damaging Het
Sycp1 C A 3: 102,898,849 probably null Het
Taf2 A C 15: 55,060,050 L277R probably damaging Het
Tbc1d23 T A 16: 57,173,106 I566F possibly damaging Het
Tekt5 T C 16: 10,361,304 T400A possibly damaging Het
Tgfbrap1 T C 1: 43,060,141 H401R probably benign Het
Tie1 T A 4: 118,476,147 I841L possibly damaging Het
Tln1 T G 4: 43,544,645 T1095P possibly damaging Het
Tmem147 A G 7: 30,728,102 Y72H probably benign Het
Tnfaip2 A G 12: 111,453,507 N691S probably benign Het
Trim24 G A 6: 37,957,783 C811Y probably damaging Het
Trim30b T A 7: 104,357,976 probably benign Het
Trpc4 T G 3: 54,194,768 L29R probably damaging Het
Ttc23l C T 15: 10,504,536 E442K probably benign Het
Uggt2 A G 14: 119,095,336 V62A probably damaging Het
Ugt1a6a C A 1: 88,138,884 S137R probably benign Het
Unc13a A G 8: 71,658,467 Y367H probably damaging Het
Vmn2r49 A G 7: 9,976,306 I833T probably benign Het
Vmn2r7 T C 3: 64,716,479 D231G probably benign Het
Ythdc2 A T 18: 44,864,357 M994L probably benign Het
Zcchc6 A T 13: 59,799,782 C506* probably null Het
Zfp804a G A 2: 82,257,588 S587N probably damaging Het
Zswim2 A G 2: 83,923,659 I219T probably benign Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18783908 splice site probably benign
IGL00862:Trpm6 APN 19 18827528 missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18877651 missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18825794 nonsense probably null
IGL01451:Trpm6 APN 19 18809569 missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18796530 nonsense probably null
IGL01995:Trpm6 APN 19 18830327 splice site probably benign
IGL02092:Trpm6 APN 19 18772331 missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18832539 missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18854063 missense probably benign
IGL02329:Trpm6 APN 19 18854217 missense probably benign 0.17
IGL02366:Trpm6 APN 19 18778510 splice site probably benign
IGL02402:Trpm6 APN 19 18786756 missense probably benign 0.18
IGL02457:Trpm6 APN 19 18825791 missense probably damaging 1.00
IGL02457:Trpm6 APN 19 18827398 nonsense probably null
IGL02684:Trpm6 APN 19 18802207 splice site probably benign
IGL02705:Trpm6 APN 19 18776733 critical splice donor site probably null
IGL02728:Trpm6 APN 19 18809652 missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18830012 splice site probably benign
IGL02818:Trpm6 APN 19 18866257 missense probably benign 0.04
IGL02836:Trpm6 APN 19 18813482 missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18838017 nonsense probably null
IGL03193:Trpm6 APN 19 18825872 missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18819119 missense probably benign 0.01
IGL03227:Trpm6 APN 19 18786779 missense probably benign 0.12
IGL03231:Trpm6 APN 19 18819181 missense probably benign
IGL03245:Trpm6 APN 19 18877701 missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18838082 missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18813486 missense probably benign
P0043:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18825802 missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18786755 missense probably benign 0.05
R0115:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18832593 missense probably benign 0.05
R0140:Trpm6 UTSW 19 18819194 splice site probably null
R0267:Trpm6 UTSW 19 18823378 missense probably benign
R0350:Trpm6 UTSW 19 18883957 splice site probably null
R0373:Trpm6 UTSW 19 18853587 missense probably benign 0.15
R0393:Trpm6 UTSW 19 18778644 missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18783025 splice site probably benign
R0505:Trpm6 UTSW 19 18873902 splice site probably benign
R0526:Trpm6 UTSW 19 18792876 missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18872221 missense probably benign 0.00
R0714:Trpm6 UTSW 19 18838087 missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18796498 missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18796495 missense probably benign 0.28
R1512:Trpm6 UTSW 19 18875931 missense probably benign
R1558:Trpm6 UTSW 19 18786828 missense probably benign 0.04
R1597:Trpm6 UTSW 19 18827524 missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18877631 missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18856217 missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18827567 missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18891999 splice site probably null
R1840:Trpm6 UTSW 19 18866267 missense probably benign 0.21
R1991:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2030:Trpm6 UTSW 19 18854265 missense probably benign
R2073:Trpm6 UTSW 19 18876042 missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18877739 missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18825752 missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2106:Trpm6 UTSW 19 18813350 missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18792090 missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18854431 missense probably benign 0.05
R3719:Trpm6 UTSW 19 18772393 nonsense probably null
R3779:Trpm6 UTSW 19 18876039 missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18832557 missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18827525 missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18796500 missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18832477 missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18832597 missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18825872 missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R4714:Trpm6 UTSW 19 18854200 missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18876064 missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18813493 missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18867981 missense probably benign 0.00
R4814:Trpm6 UTSW 19 18862212 missense probably benign 0.11
R5028:Trpm6 UTSW 19 18786760 missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18813464 missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18829933 missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18830207 missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18853604 missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18853617 missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18786819 missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18856175 missense probably benign 0.04
R5955:Trpm6 UTSW 19 18892019 missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18853748 nonsense probably null
R6105:Trpm6 UTSW 19 18853748 nonsense probably null
R6211:Trpm6 UTSW 19 18783128 missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18854291 missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18854108 missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18829990 missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18838042 missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18796439 critical splice acceptor site probably null
R6624:Trpm6 UTSW 19 18889020 missense probably damaging 1.00
R6729:Trpm6 UTSW 19 18830297 missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18783163 missense probably benign
R7103:Trpm6 UTSW 19 18813547 missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18854033 nonsense probably null
R7128:Trpm6 UTSW 19 18811773 missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18838098 missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R7263:Trpm6 UTSW 19 18876786 missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18778585 missense probably benign 0.13
R7305:Trpm6 UTSW 19 18876091 missense probably benign 0.30
R7498:Trpm6 UTSW 19 18876120 missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18778665 missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18832581 missense probably benign 0.31
R7646:Trpm6 UTSW 19 18867961 missense probably benign 0.10
R7650:Trpm6 UTSW 19 18876013 missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18854249 missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18827408 missense probably benign 0.03
R7747:Trpm6 UTSW 19 18750045 splice site probably null
R7807:Trpm6 UTSW 19 18829856 missense probably benign 0.11
R7870:Trpm6 UTSW 19 18815241 missense probably benign 0.01
R7891:Trpm6 UTSW 19 18776710 missense probably benign 0.01
R7955:Trpm6 UTSW 19 18854290 missense probably benign 0.01
R7965:Trpm6 UTSW 19 18876110 missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18778659 missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18815350 missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18792862 missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18811790 missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18873861 missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18853968 missense probably benign 0.39
R8413:Trpm6 UTSW 19 18832485 missense probably benign 0.00
R8534:Trpm6 UTSW 19 18892095 missense probably benign 0.00
R8932:Trpm6 UTSW 19 18838002 missense possibly damaging 0.87
R8990:Trpm6 UTSW 19 18815435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATTCCTTGACAGGATGTAACCC -3'
(R):5'- TGGCTGCTTTCAAAGGTCAGCAC -3'

Sequencing Primer
(F):5'- GTAACCCATTATCAGAAGTGGTCC -3'
(R):5'- TCAGCACAAAGTCTTTGGCAAG -3'
Posted On2013-07-11