Mutagenetix > Incidental Mutations

Incidental Mutation 'R7023:Scn10a'

545784

Institutional Source

Beutler Lab

Gene Symbol

Scn10a

Ensembl Gene

ENSMUSG00000034533

Gene Name

sodium channel, voltage-gated, type X, alpha

Synonyms

Nav1.8

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.183) question?

Stock #

R7023 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

119608456-119719322 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 119613544 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1545 (I1545N)

Ref Sequence

ENSEMBL: ENSMUSP00000148987 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084787] [ENSMUST00000213392] [ENSMUST00000214408]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084787
AA Change: I1546N

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000081845
Gene: ENSMUSG00000034533
AA Change: I1546N

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	129	406	7.9e-77	PFAM
low complexity region	557	572	N/A	INTRINSIC
Pfam:Ion_trans	663	898	6.8e-53	PFAM
Pfam:Na_trans_assoc	903	1148	2.7e-57	PFAM
Pfam:Ion_trans	1152	1429	8.1e-66	PFAM
Pfam:Ion_trans	1476	1734	1.9e-55	PFAM
Pfam:PKD_channel	1561	1729	3.4e-8	PFAM
IQ	1851	1873	7.57e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000213392
AA Change: I1545N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214408
AA Change: I1546N

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tetrodotoxin-resistant voltage-gated sodium channel alpha subunit. The properties of the channel formed by the encoded transmembrane protein can be altered by interaction with different beta subunits. This protein may be involved in the onset of pain associated with peripheral neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired perception of pain. Mice homozygous or heterozygous for an ENU-induced allele exhibit a catalepsy phenotype following scruffing and increased sensitivity to cold pain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	A	G	13: 119,473,907	H372R	probably benign	Het
4933405O20Rik	T	C	7: 50,600,253	I345T	probably damaging	Het
4933427D14Rik	A	G	11: 72,178,403		probably null	Het
6430548M08Rik	T	C	8: 120,145,357	V8A	probably damaging	Het
9530053A07Rik	T	A	7: 28,140,038	C425*	probably null	Het
Adam2	A	T	14: 66,043,056	D501E	probably benign	Het
Agbl3	T	C	6: 34,814,769	V602A	probably benign	Het
Akap12	T	C	10: 4,356,895	M1235T	probably benign	Het
Arid5a	G	A	1: 36,317,550		probably benign	Het
Asxl1	T	A	2: 153,400,549	D1006E	probably benign	Het
AY074887	T	C	9: 54,950,865		probably benign	Het
Btbd9	T	A	17: 30,527,572	R93S	probably benign	Het
Cabp2	A	T	19: 4,082,658		probably null	Het
Cacna1e	T	C	1: 154,725,693	D76G	probably null	Het
Cd177	A	G	7: 24,759,762	I74T	probably benign	Het
Chchd1	G	A	14: 20,703,242		probably benign	Het
Col28a1	T	C	6: 8,083,763	R565G	possibly damaging	Het
Cpvl	T	A	6: 53,967,812	I80F	probably benign	Het
Csgalnact1	T	C	8: 68,358,429	T530A	probably benign	Het
Cybrd1	A	G	2: 71,138,578	D265G	probably benign	Het
Cyp2c69	A	T	19: 39,877,542	N202K	probably benign	Het
D1Pas1	A	G	1: 186,968,008	N45D	probably damaging	Het
Dclre1a	A	G	19: 56,540,206	V839A	probably damaging	Het
Degs1	A	T	1: 182,279,065	Y210N	probably damaging	Het
Doc2g	A	G	19: 4,004,778	S220G	probably benign	Het
Epb41l2	T	A	10: 25,512,977	L885Q	probably damaging	Het
Fabp1	A	T	6: 71,203,085		probably null	Het
Fat2	G	A	11: 55,310,502	S582L	probably benign	Het
Fras1	A	G	5: 96,710,084	N2079S	probably benign	Het
Gdf6	T	C	4: 9,860,210	Y431H	probably damaging	Het
Gfra1	A	T	19: 58,454,332	L6Q	probably damaging	Het
Gm45861	T	G	8: 27,581,006	S1305A	unknown	Het
Gse1	T	C	8: 120,230,648		probably benign	Het
Kmt2e	A	G	5: 23,500,487	H1303R	possibly damaging	Het
Lck	T	C	4: 129,548,865	D499G	possibly damaging	Het
Lepr	A	T	4: 101,789,287	Y805F	probably damaging	Het
Lin7a	A	T	10: 107,382,628	Y11F	possibly damaging	Het
Lrrc43	A	G	5: 123,503,763	K559E	probably damaging	Het
Megf6	T	C	4: 154,254,145	L467P	possibly damaging	Het
Mprip	G	A	11: 59,737,389	G221R	probably damaging	Het
Myo5c	T	C	9: 75,301,456	V1683A	probably damaging	Het
Nbeal2	G	A	9: 110,638,618	R501W	probably damaging	Het
Ncf1	G	T	5: 134,225,262	A219E	possibly damaging	Het
Nckap1l	T	C	15: 103,476,066	I616T	probably benign	Het
Nlrp2	A	T	7: 5,328,229	C389*	probably null	Het
Nrg3	T	C	14: 38,376,376	E507G	probably damaging	Het
Olfr1180	A	G	2: 88,412,415	L81P	probably damaging	Het
P4ha2	A	T	11: 54,131,246	T532S	probably benign	Het
Pappa	A	T	4: 65,351,718	H1623L	probably benign	Het
Paqr6	A	G	3: 88,366,046	Y115C	probably damaging	Het
Pcolce2	A	T	9: 95,678,468	Q190L	probably benign	Het
Poll	A	G	19: 45,558,838	I65T	probably benign	Het
Prmt9	T	C	8: 77,549,457		probably benign	Het
Prpf39	T	C	12: 65,053,300	V130A	possibly damaging	Het
Prpf6	A	G	2: 181,620,640	D144G	probably damaging	Het
Rgs6	T	A	12: 83,092,104		probably benign	Het
Rimbp2	A	G	5: 128,802,783		probably null	Het
Ripor2	A	G	13: 24,671,846	T90A	probably benign	Het
Rnf150	T	C	8: 82,864,077	F23S	probably damaging	Het
Rpp40	G	A	13: 35,898,906	R200W	possibly damaging	Het
Rtp3	G	A	9: 110,986,646	S217L	probably benign	Het
Sacs	A	C	14: 61,208,815	K2770T	probably benign	Het
Scn2b	G	T	9: 45,126,140	V162L	probably damaging	Het
Sema6d	A	G	2: 124,664,911	T880A	probably damaging	Het
Slc36a4	A	G	9: 15,719,633	D16G	probably benign	Het
Slc4a8	T	A	15: 100,791,643	I378K	probably benign	Het
Smco2	T	A	6: 146,858,856	L70*	probably null	Het
Sptb	C	T	12: 76,625,088	V364I	probably damaging	Het
Susd4	A	G	1: 182,765,048	H3R	probably damaging	Het
Tbc1d16	T	C	11: 119,158,791	Q293R	probably damaging	Het
Tnfsf9	T	A	17: 57,107,317	M248K	possibly damaging	Het
Toporsl	A	G	4: 52,611,211	N368S	possibly damaging	Het
Trip11	T	C	12: 101,885,867	E361G	probably benign	Het
Trrap	T	A	5: 144,792,154	M626K	possibly damaging	Het
Ttn	A	T	2: 76,942,874	S2395T	probably damaging	Het
Ubqln3	T	C	7: 104,141,423	R487G	probably damaging	Het
Vdac1	A	G	11: 52,374,366	Y22C	probably damaging	Het
Vmn1r59	C	T	7: 5,454,478	M94I	probably benign	Het
Vmn2r10	G	T	5: 109,002,028	D383E	probably damaging	Het
Vmn2r115	T	C	17: 23,359,811	Y753H	probably damaging	Het
Vmn2r97	G	T	17: 18,914,401	C27F	probably damaging	Het
Wasf1	T	A	10: 40,936,475	V420E	unknown	Het
Zfp94	A	T	7: 24,303,396	L201Q	probably damaging	Het
Zgpat	TGGAGGAGGAGGAGGAGGA	TGGAGGAGGAGGAGGA	2: 181,366,018		probably benign	Het
Zmym4	C	A	4: 126,868,800	R1410L	probably damaging	Het

Other mutations in Scn10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Scn10a	APN	9	119672226	missense	probably damaging	1.00
IGL01339:Scn10a	APN	9	119622766	missense	probably damaging	1.00
IGL01467:Scn10a	APN	9	119658412	missense	probably benign	0.33
IGL01472:Scn10a	APN	9	119617763	missense	probably damaging	1.00
IGL01481:Scn10a	APN	9	119609194	missense	probably damaging	1.00
IGL01539:Scn10a	APN	9	119638698	missense	probably damaging	0.99
IGL01580:Scn10a	APN	9	119627159	missense	probably damaging	1.00
IGL01676:Scn10a	APN	9	119672165	nonsense	probably null
IGL01681:Scn10a	APN	9	119694077	missense	probably damaging	1.00
IGL01748:Scn10a	APN	9	119627084	missense	probably damaging	1.00
IGL01866:Scn10a	APN	9	119635502	nonsense	probably null
IGL01998:Scn10a	APN	9	119609676	missense	probably damaging	1.00
IGL02015:Scn10a	APN	9	119664951	missense	probably benign	0.09
IGL02098:Scn10a	APN	9	119691478	missense	possibly damaging	0.90
IGL02113:Scn10a	APN	9	119609890	missense	probably damaging	1.00
IGL02245:Scn10a	APN	9	119672152	missense	probably damaging	1.00
IGL02262:Scn10a	APN	9	119658433	missense	possibly damaging	0.92
IGL02317:Scn10a	APN	9	119638555	missense	probably benign	0.00
IGL02428:Scn10a	APN	9	119691562	missense	probably damaging	1.00
IGL02439:Scn10a	APN	9	119618848	missense	probably benign	0.40
IGL02583:Scn10a	APN	9	119691440	splice site	probably benign
IGL02597:Scn10a	APN	9	119610123	missense	probably damaging	0.99
IGL02680:Scn10a	APN	9	119666059	missense	probably damaging	1.00
IGL02733:Scn10a	APN	9	119616705	missense	probably damaging	1.00
IGL02851:Scn10a	APN	9	119671608	missense	probably damaging	1.00
IGL02992:Scn10a	APN	9	119609560	missense	possibly damaging	0.90
IGL03040:Scn10a	APN	9	119622985	missense	probably damaging	1.00
IGL03049:Scn10a	APN	9	119665990	missense	probably damaging	1.00
IGL03407:Scn10a	APN	9	119648171	missense	probably damaging	0.99
possum	UTSW	9	119638705	missense	probably damaging	1.00
R0025:Scn10a	UTSW	9	119670484	missense	probably damaging	1.00
R0030:Scn10a	UTSW	9	119669990	missense	probably benign	0.01
R0328:Scn10a	UTSW	9	119694102	missense	possibly damaging	0.92
R0494:Scn10a	UTSW	9	119624100	missense	probably damaging	1.00
R0511:Scn10a	UTSW	9	119613700	missense	probably damaging	0.99
R0548:Scn10a	UTSW	9	119665928	missense	probably benign	0.00
R0584:Scn10a	UTSW	9	119670531	missense	probably damaging	1.00
R0595:Scn10a	UTSW	9	119666063	missense	probably benign	0.01
R0894:Scn10a	UTSW	9	119630147	missense	probably damaging	1.00
R1022:Scn10a	UTSW	9	119609274	missense	probably damaging	1.00
R1024:Scn10a	UTSW	9	119609274	missense	probably damaging	1.00
R1263:Scn10a	UTSW	9	119617733	missense	probably damaging	1.00
R1456:Scn10a	UTSW	9	119691478	missense	probably benign	0.01
R1466:Scn10a	UTSW	9	119666490	missense	probably damaging	1.00
R1466:Scn10a	UTSW	9	119666490	missense	probably damaging	1.00
R1573:Scn10a	UTSW	9	119613626	missense	probably benign	0.04
R1704:Scn10a	UTSW	9	119609394	missense	probably damaging	1.00
R1933:Scn10a	UTSW	9	119609998	missense	probably damaging	1.00
R1945:Scn10a	UTSW	9	119691454	missense	possibly damaging	0.91
R2013:Scn10a	UTSW	9	119613736	missense	probably damaging	0.99
R2155:Scn10a	UTSW	9	119609448	missense	probably benign	0.02
R2196:Scn10a	UTSW	9	119609004	missense	probably benign
R2231:Scn10a	UTSW	9	119633850	missense	possibly damaging	0.73
R2353:Scn10a	UTSW	9	119638687	missense	probably damaging	1.00
R2392:Scn10a	UTSW	9	119627202	missense	possibly damaging	0.86
R2895:Scn10a	UTSW	9	119661401	missense	probably benign	0.00
R2926:Scn10a	UTSW	9	119638701	missense	possibly damaging	0.93
R3783:Scn10a	UTSW	9	119691562	missense	probably damaging	1.00
R3821:Scn10a	UTSW	9	119638633	missense	probably benign
R4003:Scn10a	UTSW	9	119608968	missense	probably null	0.00
R4208:Scn10a	UTSW	9	119616776	missense	probably damaging	0.99
R4231:Scn10a	UTSW	9	119631544	missense	probably damaging	0.98
R4626:Scn10a	UTSW	9	119631505	missense	possibly damaging	0.87
R4702:Scn10a	UTSW	9	119633791	missense	possibly damaging	0.59
R4713:Scn10a	UTSW	9	119609651	missense	probably damaging	1.00
R4729:Scn10a	UTSW	9	119671526	missense	probably damaging	1.00
R4782:Scn10a	UTSW	9	119622910	missense	possibly damaging	0.70
R4822:Scn10a	UTSW	9	119638672	missense	probably damaging	1.00
R4856:Scn10a	UTSW	9	119694309	missense	possibly damaging	0.46
R4856:Scn10a	UTSW	9	119694310	missense	possibly damaging	0.63
R4932:Scn10a	UTSW	9	119687874	splice site	probably null
R5015:Scn10a	UTSW	9	119622921	missense	possibly damaging	0.93
R5193:Scn10a	UTSW	9	119609655	missense	probably damaging	1.00
R5211:Scn10a	UTSW	9	119661232	missense	possibly damaging	0.87
R5320:Scn10a	UTSW	9	119648109	missense	probably damaging	1.00
R5400:Scn10a	UTSW	9	119609034	missense	probably damaging	0.99
R5448:Scn10a	UTSW	9	119687947	missense	probably benign	0.25
R5457:Scn10a	UTSW	9	119694127	missense	probably damaging	1.00
R5554:Scn10a	UTSW	9	119694130	missense	probably benign	0.01
R5680:Scn10a	UTSW	9	119624136	missense	probably damaging	1.00
R5762:Scn10a	UTSW	9	119635441	critical splice donor site	probably null
R5935:Scn10a	UTSW	9	119627171	missense	probably damaging	0.99
R5956:Scn10a	UTSW	9	119631560	missense	probably damaging	1.00
R6041:Scn10a	UTSW	9	119609469	missense	probably damaging	1.00
R6047:Scn10a	UTSW	9	119622831	missense	probably benign	0.20
R6132:Scn10a	UTSW	9	119613695	missense	possibly damaging	0.94
R6156:Scn10a	UTSW	9	119635583	missense	probably benign	0.00
R6309:Scn10a	UTSW	9	119624115	missense	possibly damaging	0.95
R6318:Scn10a	UTSW	9	119627115	missense	probably damaging	1.00
R6394:Scn10a	UTSW	9	119661320	missense	probably benign	0.36
R6711:Scn10a	UTSW	9	119609913	missense	probably damaging	1.00
R6751:Scn10a	UTSW	9	119671551	missense	probably damaging	1.00
R6877:Scn10a	UTSW	9	119609782	missense	probably damaging	0.96
R6909:Scn10a	UTSW	9	119609790	missense	probably damaging	1.00
R7205:Scn10a	UTSW	9	119613550	missense	probably damaging	0.99
R7254:Scn10a	UTSW	9	119618855	missense	probably damaging	0.99
R7261:Scn10a	UTSW	9	119609724	missense	probably damaging	0.97
R7283:Scn10a	UTSW	9	119664779	critical splice donor site	probably null
R7453:Scn10a	UTSW	9	119638552	missense	probably benign
R7561:Scn10a	UTSW	9	119694324	start codon destroyed	probably null	0.66
R7590:Scn10a	UTSW	9	119666400	missense	probably damaging	1.00
R7759:Scn10a	UTSW	9	119648132	nonsense	probably null
R7765:Scn10a	UTSW	9	119609904	missense	possibly damaging	0.90
R7851:Scn10a	UTSW	9	119617762	missense	probably damaging	0.99
R7875:Scn10a	UTSW	9	119635442	critical splice donor site	probably null
R7934:Scn10a	UTSW	9	119617762	missense	probably damaging	0.99
R7958:Scn10a	UTSW	9	119635442	critical splice donor site	probably null
R8010:Scn10a	UTSW	9	119661167	missense	possibly damaging	0.56
R8027:Scn10a	UTSW	9	119633790	missense	probably damaging	0.99
X0058:Scn10a	UTSW	9	119609364	nonsense	probably null
Z1177:Scn10a	UTSW	9	119624145	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AAATGTGAGCTGAGCCTGGG -3'
(R):5'- GTGACCAGGCAAGCATTTG -3'

Sequencing Primer
(F):5'- AGCGCTTATACCAGAGGAGTCTTC -3'
(R):5'- GTGACCAGGCAAGCATTTGACATC -3'

Posted On

2019-05-13