Incidental Mutation 'R7023:Vdac1'
ID 545789
Institutional Source Beutler Lab
Gene Symbol Vdac1
Ensembl Gene ENSMUSG00000020402
Gene Name voltage-dependent anion channel 1
Synonyms Vdac5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.729) question?
Stock # R7023 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 52360860-52389397 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 52374366 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 22 (Y22C)
Ref Sequence ENSEMBL: ENSMUSP00000116919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020673] [ENSMUST00000102758] [ENSMUST00000125694]
AlphaFold Q60932
Predicted Effect probably damaging
Transcript: ENSMUST00000020673
AA Change: Y35C

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020673
Gene: ENSMUSG00000020402
AA Change: Y35C

DomainStartEndE-ValueType
Pfam:Porin_3 16 289 1.7e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102758
AA Change: Y22C

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099819
Gene: ENSMUSG00000020402
AA Change: Y22C

DomainStartEndE-ValueType
Pfam:Porin_3 3 276 7.6e-80 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125694
AA Change: Y22C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116919
Gene: ENSMUSG00000020402
AA Change: Y22C

DomainStartEndE-ValueType
Pfam:Porin_3 3 235 1.7e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a voltage-dependent anion channel protein that is a major component of the outer mitochondrial membrane. The encoded protein facilitates the exchange of metabolites and ions across the outer mitochondrial membrane and may regulate mitochondrial functions. This protein also forms channels in the plasma membrane and may be involved in transmembrane electron transport. Multiple pseudogenes of this gene are found on chromosomes 1, 2, 3, 6, 8, 9, and X. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants exhibit approximately 60% embryonic mortality, with loss occurring at embryonic day 10.5-11.5. Survivors exhibit defective cued fear conditioning and spatial learning. Heterozygotes also exhibit about 12% prenatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,473,907 H372R probably benign Het
4933405O20Rik T C 7: 50,600,253 I345T probably damaging Het
4933427D14Rik A G 11: 72,178,403 probably null Het
6430548M08Rik T C 8: 120,145,357 V8A probably damaging Het
9530053A07Rik T A 7: 28,140,038 C425* probably null Het
Adam2 A T 14: 66,043,056 D501E probably benign Het
Agbl3 T C 6: 34,814,769 V602A probably benign Het
Akap12 T C 10: 4,356,895 M1235T probably benign Het
Arid5a G A 1: 36,317,550 probably benign Het
Asxl1 T A 2: 153,400,549 D1006E probably benign Het
AY074887 T C 9: 54,950,865 probably benign Het
Btbd9 T A 17: 30,527,572 R93S probably benign Het
Cabp2 A T 19: 4,082,658 probably null Het
Cacna1e T C 1: 154,725,693 D76G probably null Het
Cd177 A G 7: 24,759,762 I74T probably benign Het
Chchd1 G A 14: 20,703,242 probably benign Het
Col28a1 T C 6: 8,083,763 R565G possibly damaging Het
Cpvl T A 6: 53,967,812 I80F probably benign Het
Csgalnact1 T C 8: 68,358,429 T530A probably benign Het
Cybrd1 A G 2: 71,138,578 D265G probably benign Het
Cyp2c69 A T 19: 39,877,542 N202K probably benign Het
D1Pas1 A G 1: 186,968,008 N45D probably damaging Het
Dclre1a A G 19: 56,540,206 V839A probably damaging Het
Degs1 A T 1: 182,279,065 Y210N probably damaging Het
Doc2g A G 19: 4,004,778 S220G probably benign Het
Epb41l2 T A 10: 25,512,977 L885Q probably damaging Het
Fabp1 A T 6: 71,203,085 probably null Het
Fat2 G A 11: 55,310,502 S582L probably benign Het
Fras1 A G 5: 96,710,084 N2079S probably benign Het
Gdf6 T C 4: 9,860,210 Y431H probably damaging Het
Gfra1 A T 19: 58,454,332 L6Q probably damaging Het
Gm45861 T G 8: 27,581,006 S1305A unknown Het
Gse1 T C 8: 120,230,648 probably benign Het
Kmt2e A G 5: 23,500,487 H1303R possibly damaging Het
Lck T C 4: 129,548,865 D499G possibly damaging Het
Lepr A T 4: 101,789,287 Y805F probably damaging Het
Lin7a A T 10: 107,382,628 Y11F possibly damaging Het
Lrrc43 A G 5: 123,503,763 K559E probably damaging Het
Megf6 T C 4: 154,254,145 L467P possibly damaging Het
Mprip G A 11: 59,737,389 G221R probably damaging Het
Myo5c T C 9: 75,301,456 V1683A probably damaging Het
Nbeal2 G A 9: 110,638,618 R501W probably damaging Het
Ncf1 G T 5: 134,225,262 A219E possibly damaging Het
Nckap1l T C 15: 103,476,066 I616T probably benign Het
Nlrp2 A T 7: 5,328,229 C389* probably null Het
Nrg3 T C 14: 38,376,376 E507G probably damaging Het
Olfr1180 A G 2: 88,412,415 L81P probably damaging Het
P4ha2 A T 11: 54,131,246 T532S probably benign Het
Pappa A T 4: 65,351,718 H1623L probably benign Het
Paqr6 A G 3: 88,366,046 Y115C probably damaging Het
Pcolce2 A T 9: 95,678,468 Q190L probably benign Het
Poll A G 19: 45,558,838 I65T probably benign Het
Prmt9 T C 8: 77,549,457 probably benign Het
Prpf39 T C 12: 65,053,300 V130A possibly damaging Het
Prpf6 A G 2: 181,620,640 D144G probably damaging Het
Rgs6 T A 12: 83,092,104 probably benign Het
Rimbp2 A G 5: 128,802,783 probably null Het
Ripor2 A G 13: 24,671,846 T90A probably benign Het
Rnf150 T C 8: 82,864,077 F23S probably damaging Het
Rpp40 G A 13: 35,898,906 R200W possibly damaging Het
Rtp3 G A 9: 110,986,646 S217L probably benign Het
Sacs A C 14: 61,208,815 K2770T probably benign Het
Scn10a A T 9: 119,613,544 I1545N probably damaging Het
Scn2b G T 9: 45,126,140 V162L probably damaging Het
Sema6d A G 2: 124,664,911 T880A probably damaging Het
Slc36a4 A G 9: 15,719,633 D16G probably benign Het
Slc4a8 T A 15: 100,791,643 I378K probably benign Het
Smco2 T A 6: 146,858,856 L70* probably null Het
Sptb C T 12: 76,625,088 V364I probably damaging Het
Susd4 A G 1: 182,765,048 H3R probably damaging Het
Tbc1d16 T C 11: 119,158,791 Q293R probably damaging Het
Tnfsf9 T A 17: 57,107,317 M248K possibly damaging Het
Toporsl A G 4: 52,611,211 N368S possibly damaging Het
Trip11 T C 12: 101,885,867 E361G probably benign Het
Trrap T A 5: 144,792,154 M626K possibly damaging Het
Ttn A T 2: 76,942,874 S2395T probably damaging Het
Ubqln3 T C 7: 104,141,423 R487G probably damaging Het
Vmn1r59 C T 7: 5,454,478 M94I probably benign Het
Vmn2r10 G T 5: 109,002,028 D383E probably damaging Het
Vmn2r115 T C 17: 23,359,811 Y753H probably damaging Het
Vmn2r97 G T 17: 18,914,401 C27F probably damaging Het
Wasf1 T A 10: 40,936,475 V420E unknown Het
Zfp94 A T 7: 24,303,396 L201Q probably damaging Het
Zgpat TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 2: 181,366,018 probably benign Het
Zmym4 C A 4: 126,868,800 R1410L probably damaging Het
Other mutations in Vdac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Vdac1 APN 11 52385662 missense probably benign 0.02
IGL02057:Vdac1 APN 11 52376544 critical splice donor site probably null
IGL03223:Vdac1 APN 11 52376655 missense probably benign
IGL03225:Vdac1 APN 11 52376655 missense probably benign
R0362:Vdac1 UTSW 11 52374973 splice site probably benign
R1612:Vdac1 UTSW 11 52384070 missense probably benign 0.03
R1694:Vdac1 UTSW 11 52374363 missense probably damaging 0.96
R2512:Vdac1 UTSW 11 52384077 missense probably damaging 1.00
R3717:Vdac1 UTSW 11 52376646 critical splice acceptor site probably null
R4592:Vdac1 UTSW 11 52374972 splice site probably null
R5027:Vdac1 UTSW 11 52388478 missense possibly damaging 0.75
R5209:Vdac1 UTSW 11 52376452 missense probably damaging 0.99
R5256:Vdac1 UTSW 11 52384078 critical splice donor site probably null
R5413:Vdac1 UTSW 11 52374967 missense probably null 0.17
R5762:Vdac1 UTSW 11 52387453 missense possibly damaging 0.77
R6276:Vdac1 UTSW 11 52376482 missense possibly damaging 0.84
R6954:Vdac1 UTSW 11 52386373 missense probably damaging 1.00
R7261:Vdac1 UTSW 11 52374934 missense probably damaging 0.98
R8414:Vdac1 UTSW 11 52376503 missense possibly damaging 0.69
R8847:Vdac1 UTSW 11 52376403 missense
R9276:Vdac1 UTSW 11 52383962 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCTGAGACTTAGAGCTGAG -3'
(R):5'- AGCTTGCAAGGGACTAGATCTG -3'

Sequencing Primer
(F):5'- ACTTAGAGCTGAGTGATTTTTATTGG -3'
(R):5'- CAAGGGACTAGATCTGCCATTTGC -3'
Posted On 2019-05-13