Incidental Mutation 'R7023:Trip11'
ID545798
Institutional Source Beutler Lab
Gene Symbol Trip11
Ensembl Gene ENSMUSG00000021188
Gene Namethyroid hormone receptor interactor 11
SynonymsGMAP-210, 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230
MMRRC Submission
Accession Numbers

Genbank: NM_028446.1; Ensembl: ENSMUST00000021605, ENSMUST00000085086, ENSMUST00000110038

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7023 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location101834043-101913267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101885867 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 361 (E361G)
Ref Sequence ENSEMBL: ENSMUSP00000134976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000176728] [ENSMUST00000177183] [ENSMUST00000177536]
Predicted Effect probably benign
Transcript: ENSMUST00000021605
AA Change: E646G

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: E646G

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 54 130 N/A INTRINSIC
coiled coil region 167 194 N/A INTRINSIC
coiled coil region 218 702 N/A INTRINSIC
coiled coil region 754 990 N/A INTRINSIC
coiled coil region 1022 1051 N/A INTRINSIC
coiled coil region 1196 1261 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
coiled coil region 1336 1481 N/A INTRINSIC
coiled coil region 1547 1657 N/A INTRINSIC
coiled coil region 1681 1771 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176728
SMART Domains Protein: ENSMUSP00000134992
Gene: ENSMUSG00000021188

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
Pfam:Orthopox_A5L 48 282 6.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177183
AA Change: E361G

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: E361G

DomainStartEndE-ValueType
coiled coil region 33 158 N/A INTRINSIC
coiled coil region 179 417 N/A INTRINSIC
coiled coil region 469 705 N/A INTRINSIC
coiled coil region 737 766 N/A INTRINSIC
coiled coil region 911 976 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
coiled coil region 1051 1196 N/A INTRINSIC
coiled coil region 1262 1372 N/A INTRINSIC
coiled coil region 1396 1486 N/A INTRINSIC
low complexity region 1649 1660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177480
Predicted Effect probably benign
Transcript: ENSMUST00000177536
SMART Domains Protein: ENSMUSP00000135669
Gene: ENSMUSG00000021188

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 53 129 N/A INTRINSIC
coiled coil region 166 193 N/A INTRINSIC
coiled coil region 217 517 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,473,907 H372R probably benign Het
4933405O20Rik T C 7: 50,600,253 I345T probably damaging Het
4933427D14Rik A G 11: 72,178,403 probably null Het
6430548M08Rik T C 8: 120,145,357 V8A probably damaging Het
9530053A07Rik T A 7: 28,140,038 C425* probably null Het
Adam2 A T 14: 66,043,056 D501E probably benign Het
Agbl3 T C 6: 34,814,769 V602A probably benign Het
Akap12 T C 10: 4,356,895 M1235T probably benign Het
Arid5a G A 1: 36,317,550 probably benign Het
Asxl1 T A 2: 153,400,549 D1006E probably benign Het
AY074887 T C 9: 54,950,865 probably benign Het
Btbd9 T A 17: 30,527,572 R93S probably benign Het
Cabp2 A T 19: 4,082,658 probably null Het
Cacna1e T C 1: 154,725,693 D76G probably null Het
Cd177 A G 7: 24,759,762 I74T probably benign Het
Chchd1 G A 14: 20,703,242 probably benign Het
Col28a1 T C 6: 8,083,763 R565G possibly damaging Het
Cpvl T A 6: 53,967,812 I80F probably benign Het
Csgalnact1 T C 8: 68,358,429 T530A probably benign Het
Cybrd1 A G 2: 71,138,578 D265G probably benign Het
Cyp2c69 A T 19: 39,877,542 N202K probably benign Het
D1Pas1 A G 1: 186,968,008 N45D probably damaging Het
Dclre1a A G 19: 56,540,206 V839A probably damaging Het
Degs1 A T 1: 182,279,065 Y210N probably damaging Het
Doc2g A G 19: 4,004,778 S220G probably benign Het
Epb41l2 T A 10: 25,512,977 L885Q probably damaging Het
Fabp1 A T 6: 71,203,085 probably null Het
Fat2 G A 11: 55,310,502 S582L probably benign Het
Fras1 A G 5: 96,710,084 N2079S probably benign Het
Gdf6 T C 4: 9,860,210 Y431H probably damaging Het
Gfra1 A T 19: 58,454,332 L6Q probably damaging Het
Gm45861 T G 8: 27,581,006 S1305A unknown Het
Gse1 T C 8: 120,230,648 probably benign Het
Kmt2e A G 5: 23,500,487 H1303R possibly damaging Het
Lck T C 4: 129,548,865 D499G possibly damaging Het
Lepr A T 4: 101,789,287 Y805F probably damaging Het
Lin7a A T 10: 107,382,628 Y11F possibly damaging Het
Lrrc43 A G 5: 123,503,763 K559E probably damaging Het
Megf6 T C 4: 154,254,145 L467P possibly damaging Het
Mprip G A 11: 59,737,389 G221R probably damaging Het
Myo5c T C 9: 75,301,456 V1683A probably damaging Het
Nbeal2 G A 9: 110,638,618 R501W probably damaging Het
Ncf1 G T 5: 134,225,262 A219E possibly damaging Het
Nckap1l T C 15: 103,476,066 I616T probably benign Het
Nlrp2 A T 7: 5,328,229 C389* probably null Het
Nrg3 T C 14: 38,376,376 E507G probably damaging Het
Olfr1180 A G 2: 88,412,415 L81P probably damaging Het
P4ha2 A T 11: 54,131,246 T532S probably benign Het
Pappa A T 4: 65,351,718 H1623L probably benign Het
Paqr6 A G 3: 88,366,046 Y115C probably damaging Het
Pcolce2 A T 9: 95,678,468 Q190L probably benign Het
Poll A G 19: 45,558,838 I65T probably benign Het
Prmt9 T C 8: 77,549,457 probably benign Het
Prpf39 T C 12: 65,053,300 V130A possibly damaging Het
Prpf6 A G 2: 181,620,640 D144G probably damaging Het
Rgs6 T A 12: 83,092,104 probably benign Het
Rimbp2 A G 5: 128,802,783 probably null Het
Ripor2 A G 13: 24,671,846 T90A probably benign Het
Rnf150 T C 8: 82,864,077 F23S probably damaging Het
Rpp40 G A 13: 35,898,906 R200W possibly damaging Het
Rtp3 G A 9: 110,986,646 S217L probably benign Het
Sacs A C 14: 61,208,815 K2770T probably benign Het
Scn10a A T 9: 119,613,544 I1545N probably damaging Het
Scn2b G T 9: 45,126,140 V162L probably damaging Het
Sema6d A G 2: 124,664,911 T880A probably damaging Het
Slc36a4 A G 9: 15,719,633 D16G probably benign Het
Slc4a8 T A 15: 100,791,643 I378K probably benign Het
Smco2 T A 6: 146,858,856 L70* probably null Het
Sptb C T 12: 76,625,088 V364I probably damaging Het
Susd4 A G 1: 182,765,048 H3R probably damaging Het
Tbc1d16 T C 11: 119,158,791 Q293R probably damaging Het
Tnfsf9 T A 17: 57,107,317 M248K possibly damaging Het
Toporsl A G 4: 52,611,211 N368S possibly damaging Het
Trrap T A 5: 144,792,154 M626K possibly damaging Het
Ttn A T 2: 76,942,874 S2395T probably damaging Het
Ubqln3 T C 7: 104,141,423 R487G probably damaging Het
Vdac1 A G 11: 52,374,366 Y22C probably damaging Het
Vmn1r59 C T 7: 5,454,478 M94I probably benign Het
Vmn2r10 G T 5: 109,002,028 D383E probably damaging Het
Vmn2r115 T C 17: 23,359,811 Y753H probably damaging Het
Vmn2r97 G T 17: 18,914,401 C27F probably damaging Het
Wasf1 T A 10: 40,936,475 V420E unknown Het
Zfp94 A T 7: 24,303,396 L201Q probably damaging Het
Zgpat TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 2: 181,366,018 probably benign Het
Zmym4 C A 4: 126,868,800 R1410L probably damaging Het
Other mutations in Trip11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Trip11 APN 12 101886147 missense probably benign 0.37
IGL00484:Trip11 APN 12 101885311 nonsense probably null
IGL00972:Trip11 APN 12 101894337 missense probably null 1.00
IGL01476:Trip11 APN 12 101898911 missense probably damaging 0.96
IGL01591:Trip11 APN 12 101883345 missense probably damaging 0.98
IGL01667:Trip11 APN 12 101878862 missense probably damaging 1.00
IGL01764:Trip11 APN 12 101884631 missense probably damaging 1.00
IGL01789:Trip11 APN 12 101871831 missense probably benign 0.05
IGL01814:Trip11 APN 12 101884488 missense probably damaging 0.98
IGL01898:Trip11 APN 12 101885676 missense probably benign
IGL01924:Trip11 APN 12 101886884 missense possibly damaging 0.93
IGL02020:Trip11 APN 12 101884313 missense probably damaging 1.00
IGL02475:Trip11 APN 12 101895683 missense probably benign 0.01
IGL02544:Trip11 APN 12 101893521 missense probably damaging 1.00
IGL02678:Trip11 APN 12 101883390 missense probably damaging 0.96
IGL02714:Trip11 APN 12 101884001 missense probably damaging 1.00
IGL02718:Trip11 APN 12 101886025 missense probably benign 0.24
IGL02904:Trip11 APN 12 101886838 missense probably damaging 1.00
IGL03012:Trip11 APN 12 101883936 missense probably damaging 1.00
IGL03191:Trip11 APN 12 101898925 missense probably damaging 1.00
IGL03327:Trip11 APN 12 101883418 missense possibly damaging 0.87
IGL03337:Trip11 APN 12 101885019 missense probably damaging 1.00
NA:Trip11 UTSW 12 101894321 unclassified probably null
R0027:Trip11 UTSW 12 101885169 missense probably benign 0.00
R0028:Trip11 UTSW 12 101884757 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0505:Trip11 UTSW 12 101885672 missense probably damaging 0.98
R0556:Trip11 UTSW 12 101884518 nonsense probably null
R0573:Trip11 UTSW 12 101886860 missense probably benign 0.02
R0626:Trip11 UTSW 12 101885976 missense possibly damaging 0.54
R1519:Trip11 UTSW 12 101886160 missense probably benign 0.04
R1530:Trip11 UTSW 12 101912767 missense unknown
R1647:Trip11 UTSW 12 101884392 nonsense probably null
R1648:Trip11 UTSW 12 101884392 nonsense probably null
R1856:Trip11 UTSW 12 101883333 nonsense probably null
R2013:Trip11 UTSW 12 101837722 missense probably damaging 1.00
R2017:Trip11 UTSW 12 101885360 missense probably benign 0.00
R2206:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2207:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2304:Trip11 UTSW 12 101898977 missense possibly damaging 0.58
R2328:Trip11 UTSW 12 101878827 makesense probably null
R2513:Trip11 UTSW 12 101837727 missense possibly damaging 0.94
R3499:Trip11 UTSW 12 101893694 missense possibly damaging 0.87
R4105:Trip11 UTSW 12 101894322 nonsense probably null
R4124:Trip11 UTSW 12 101895698 nonsense probably null
R4126:Trip11 UTSW 12 101895698 nonsense probably null
R4128:Trip11 UTSW 12 101895698 nonsense probably null
R4175:Trip11 UTSW 12 101895698 nonsense probably null
R4176:Trip11 UTSW 12 101895698 nonsense probably null
R4181:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4296:Trip11 UTSW 12 101885868 nonsense probably null
R4302:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4306:Trip11 UTSW 12 101886939 missense probably benign
R4342:Trip11 UTSW 12 101884316 missense probably damaging 1.00
R4576:Trip11 UTSW 12 101886240 nonsense probably null
R4586:Trip11 UTSW 12 101883341 missense possibly damaging 0.55
R4634:Trip11 UTSW 12 101837616 missense probably damaging 1.00
R4696:Trip11 UTSW 12 101885290 missense possibly damaging 0.71
R4792:Trip11 UTSW 12 101885446 missense probably benign 0.10
R4903:Trip11 UTSW 12 101886806 critical splice donor site probably null
R5001:Trip11 UTSW 12 101884910 nonsense probably null
R5017:Trip11 UTSW 12 101846620 missense probably benign 0.00
R5227:Trip11 UTSW 12 101884920 missense probably damaging 1.00
R5231:Trip11 UTSW 12 101885601 missense probably damaging 0.96
R5539:Trip11 UTSW 12 101885127 missense probably damaging 0.98
R5754:Trip11 UTSW 12 101885665 nonsense probably null
R5755:Trip11 UTSW 12 101885665 nonsense probably null
R5890:Trip11 UTSW 12 101885972 missense probably damaging 0.99
R5910:Trip11 UTSW 12 101883479 missense probably damaging 1.00
R6083:Trip11 UTSW 12 101889742 missense probably benign 0.00
R6208:Trip11 UTSW 12 101898895 missense probably damaging 1.00
R6216:Trip11 UTSW 12 101890600 missense probably benign 0.31
R6315:Trip11 UTSW 12 101885578 missense possibly damaging 0.84
R6413:Trip11 UTSW 12 101885531 missense probably benign 0.12
R6590:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6690:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6914:Trip11 UTSW 12 101846620 missense probably benign 0.00
R6938:Trip11 UTSW 12 101837627 missense probably damaging 0.98
R7015:Trip11 UTSW 12 101893683 missense probably damaging 1.00
R7133:Trip11 UTSW 12 101884070 missense probably damaging 0.97
R7271:Trip11 UTSW 12 101884352 missense probably damaging 1.00
R7424:Trip11 UTSW 12 101885198 missense probably damaging 1.00
R7431:Trip11 UTSW 12 101884019 missense possibly damaging 0.84
R7472:Trip11 UTSW 12 101885380 missense probably benign 0.00
R7491:Trip11 UTSW 12 101885435 missense probably damaging 1.00
X0020:Trip11 UTSW 12 101885913 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAATCTGCTTGTTGCCAGC -3'
(R):5'- GGCCCTAAGTGATTTACAGTTAACC -3'

Sequencing Primer
(F):5'- TGCCAGCAACAGATTCTTCC -3'
(R):5'- TACAGTTAACCAAACAGAAGCTTG -3'
Posted On2019-05-13