Incidental Mutation 'R7024:Rab3gap1'
ID545819
Institutional Source Beutler Lab
Gene Symbol Rab3gap1
Ensembl Gene ENSMUSG00000036104
Gene NameRAB3 GTPase activating protein subunit 1
Synonyms1700003B17Rik, p130, 4732493F09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R7024 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location127868773-127943868 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 127891098 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037649] [ENSMUST00000212506]
Predicted Effect probably null
Transcript: ENSMUST00000037649
SMART Domains Protein: ENSMUSP00000042070
Gene: ENSMUSG00000036104

DomainStartEndE-ValueType
low complexity region 254 263 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
Pfam:Rab3-GTPase_cat 612 769 2.9e-67 PFAM
low complexity region 856 868 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000212506
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of a Rab GTPase activating protein. The encoded protein forms a heterodimer with a non-catalytic subunit to specifically regulate the activity of members of the Rab3 subfamily of small G proteins. This protein mediates the hydrolysis of GTP bound Rab3 to the GDP bound form. Mutations in this gene are associated with Warburg micro syndrome. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display abnormal synaptic transmission but have normal gross brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,220 S128P probably damaging Het
Abcc1 G C 16: 14,413,383 probably null Het
Armc4 A C 18: 7,211,593 D760E probably benign Het
Atg2a G A 19: 6,250,219 G686S possibly damaging Het
Atrnl1 A T 19: 57,638,450 probably null Het
Brd4 T C 17: 32,221,910 probably benign Het
C77080 T A 4: 129,225,408 E173V probably null Het
Camsap3 A G 8: 3,608,242 E688G probably damaging Het
Cc2d2a T A 5: 43,733,929 S1402R probably benign Het
Ccnb1 A G 13: 100,786,380 probably null Het
Cdc42bpb G A 12: 111,326,085 H339Y probably damaging Het
Ciart T A 3: 95,879,080 T94S probably benign Het
Col6a5 T A 9: 105,912,475 K1540* probably null Het
Csmd3 A T 15: 47,710,991 V1969E probably damaging Het
Dgka T G 10: 128,720,487 N710T probably damaging Het
Dock6 A G 9: 21,820,370 V1212A probably benign Het
En1 C T 1: 120,603,322 P97L unknown Het
Esd T A 14: 74,744,662 F172L probably damaging Het
Gfer C A 17: 24,695,968 D34Y probably damaging Het
Gm2832 G A 14: 41,279,739 M68I Het
Hmgcr A G 13: 96,658,910 S384P probably benign Het
Hsp90aa1 T C 12: 110,694,112 T299A possibly damaging Het
Igsf10 A G 3: 59,331,701 M353T probably benign Het
Ino80b T C 6: 83,122,325 T211A probably benign Het
Lamb2 C A 9: 108,489,488 T1607K probably benign Het
Lhfpl5 A G 17: 28,582,983 E218G probably benign Het
Lpo C A 11: 87,816,443 C248F probably damaging Het
Lrrc3 C T 10: 77,900,991 D204N probably damaging Het
Mavs C A 2: 131,243,131 L160I probably benign Het
Morn4 C T 19: 42,078,044 D35N possibly damaging Het
Mroh8 G A 2: 157,221,263 H813Y probably benign Het
Myf6 T C 10: 107,494,529 E59G probably damaging Het
Nlrp10 T A 7: 108,925,198 E358D possibly damaging Het
Olfr1009 T A 2: 85,721,608 F68I probably damaging Het
Olfr107 T C 17: 37,406,204 F219L probably benign Het
Olfr1120 A G 2: 87,357,722 T93A probably benign Het
Olfr396-ps1 T A 11: 73,928,506 L94* probably null Het
Olfr525 T C 7: 140,322,846 I49T possibly damaging Het
Olfr846 T C 9: 19,361,283 E24G possibly damaging Het
Optn T C 2: 5,052,837 probably null Het
Plxna4 T A 6: 32,192,269 H1331L probably damaging Het
Poli A T 18: 70,516,849 M357K possibly damaging Het
Psd4 T G 2: 24,394,543 C140G possibly damaging Het
Rasa3 T C 8: 13,631,826 N41S probably benign Het
Rps6kc1 A G 1: 190,800,210 S532P probably benign Het
S100a3 T A 3: 90,602,440 probably null Het
Sfrp5 T C 19: 42,201,765 K83E possibly damaging Het
Slco1a4 T C 6: 141,834,708 I119V probably benign Het
Snx15 T A 19: 6,120,596 Q271L probably damaging Het
Sorcs2 C A 5: 36,021,261 S1128I probably damaging Het
Tbc1d7 A T 13: 43,154,735 F85I probably damaging Het
Thoc7 A G 14: 13,953,528 Y46H probably damaging Het
Top1mt T A 15: 75,667,448 Y366F probably damaging Het
Trpv2 C A 11: 62,584,461 S233R probably benign Het
Vav1 C A 17: 57,279,268 T24N probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy4 G T 14: 32,964,626 probably null Het
Wdr3 A G 3: 100,154,997 S201P probably benign Het
Wdr34 A G 2: 30,038,266 V116A possibly damaging Het
Wfs1 C T 5: 36,966,950 D866N probably damaging Het
Wnk1 A T 6: 119,965,726 probably benign Het
Xpot G T 10: 121,602,399 Q762K probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Other mutations in Rab3gap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Rab3gap1 APN 1 127930387 splice site probably benign
IGL01467:Rab3gap1 APN 1 127930384 splice site probably null
IGL01554:Rab3gap1 APN 1 127928008 missense possibly damaging 0.82
IGL01773:Rab3gap1 APN 1 127918221 missense possibly damaging 0.64
IGL01866:Rab3gap1 APN 1 127891080 missense probably damaging 1.00
IGL02078:Rab3gap1 APN 1 127868915 splice site probably benign
IGL02251:Rab3gap1 APN 1 127937500 missense probably benign 0.25
IGL02268:Rab3gap1 APN 1 127868958 missense probably damaging 1.00
IGL02274:Rab3gap1 APN 1 127939080 missense probably benign
IGL02372:Rab3gap1 APN 1 127919561 splice site probably benign
IGL02399:Rab3gap1 APN 1 127928103 missense possibly damaging 0.93
IGL02629:Rab3gap1 APN 1 127909863 missense probably benign 0.01
IGL02700:Rab3gap1 APN 1 127938605 missense probably benign 0.06
IGL02748:Rab3gap1 APN 1 127937461 missense probably damaging 0.99
little_bighorn UTSW 1 127891098 critical splice donor site probably null
IGL03048:Rab3gap1 UTSW 1 127937477 missense probably damaging 1.00
R0828:Rab3gap1 UTSW 1 127938185 splice site probably benign
R1382:Rab3gap1 UTSW 1 127942596 missense probably damaging 0.97
R1729:Rab3gap1 UTSW 1 127942486 missense probably damaging 1.00
R1809:Rab3gap1 UTSW 1 127934514 missense probably damaging 0.99
R1990:Rab3gap1 UTSW 1 127942429 missense possibly damaging 0.56
R2001:Rab3gap1 UTSW 1 127903719 missense possibly damaging 0.95
R2041:Rab3gap1 UTSW 1 127937990 missense possibly damaging 0.78
R3955:Rab3gap1 UTSW 1 127934517 missense probably damaging 1.00
R4192:Rab3gap1 UTSW 1 127925470 intron probably benign
R4243:Rab3gap1 UTSW 1 127937567 critical splice donor site probably null
R4244:Rab3gap1 UTSW 1 127937567 critical splice donor site probably null
R4354:Rab3gap1 UTSW 1 127915641 missense probably benign 0.02
R4592:Rab3gap1 UTSW 1 127925259 intron probably benign
R4622:Rab3gap1 UTSW 1 127942419 missense probably benign 0.00
R4738:Rab3gap1 UTSW 1 127934436 missense probably damaging 0.99
R4917:Rab3gap1 UTSW 1 127889177 missense possibly damaging 0.75
R4918:Rab3gap1 UTSW 1 127889177 missense possibly damaging 0.75
R5090:Rab3gap1 UTSW 1 127915678 missense probably benign 0.35
R5197:Rab3gap1 UTSW 1 127889194 missense probably benign
R5310:Rab3gap1 UTSW 1 127942373 critical splice acceptor site probably null
R5580:Rab3gap1 UTSW 1 127930990 missense probably benign 0.01
R6670:Rab3gap1 UTSW 1 127930775 missense probably benign
R6825:Rab3gap1 UTSW 1 127930421 missense probably damaging 1.00
R7274:Rab3gap1 UTSW 1 127927512 missense probably benign
R7380:Rab3gap1 UTSW 1 127937990 missense possibly damaging 0.78
R7583:Rab3gap1 UTSW 1 127930875 missense probably benign 0.03
R7654:Rab3gap1 UTSW 1 127909915 missense probably damaging 1.00
R8309:Rab3gap1 UTSW 1 127909918 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AAGACATGCTTTCCTCAAGGC -3'
(R):5'- AGTCAATCACTGAACCTAGAGTTAG -3'

Sequencing Primer
(F):5'- GCTTTCCTCAAGGCATGTATAAAATC -3'
(R):5'- TGGTCTATACAGAGTTCACGGAC -3'
Posted On2019-05-13