Incidental Mutation 'R7024:Rps6kc1'
ID545820
Institutional Source Beutler Lab
Gene Symbol Rps6kc1
Ensembl Gene ENSMUSG00000089872
Gene Nameribosomal protein S6 kinase polypeptide 1
SynonymsRPK118
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7024 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location190700202-190911770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 190800210 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 532 (S532P)
Ref Sequence ENSEMBL: ENSMUSP00000061769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061611] [ENSMUST00000159367] [ENSMUST00000159624]
Predicted Effect probably benign
Transcript: ENSMUST00000061611
AA Change: S532P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000061769
Gene: ENSMUSG00000089872
AA Change: S532P

DomainStartEndE-ValueType
PX 9 128 1.26e-13 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
MIT 235 313 1.12e-20 SMART
low complexity region 317 332 N/A INTRINSIC
SCOP:d1apme_ 347 417 2e-5 SMART
low complexity region 443 454 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 669 681 N/A INTRINSIC
Pfam:Pkinase 863 1046 4.4e-26 PFAM
Pfam:Pkinase_Tyr 876 1032 5.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159367
SMART Domains Protein: ENSMUSP00000124383
Gene: ENSMUSG00000089872

DomainStartEndE-ValueType
Blast:PX 9 50 4e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159624
SMART Domains Protein: ENSMUSP00000125010
Gene: ENSMUSG00000089872

DomainStartEndE-ValueType
PX 9 128 1.26e-13 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
Pfam:MIT 238 299 6.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160889
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,220 S128P probably damaging Het
Abcc1 G C 16: 14,413,383 probably null Het
Armc4 A C 18: 7,211,593 D760E probably benign Het
Atg2a G A 19: 6,250,219 G686S possibly damaging Het
Atrnl1 A T 19: 57,638,450 probably null Het
Brd4 T C 17: 32,221,910 probably benign Het
C77080 T A 4: 129,225,408 E173V probably null Het
Camsap3 A G 8: 3,608,242 E688G probably damaging Het
Cc2d2a T A 5: 43,733,929 S1402R probably benign Het
Ccnb1 A G 13: 100,786,380 probably null Het
Cdc42bpb G A 12: 111,326,085 H339Y probably damaging Het
Ciart T A 3: 95,879,080 T94S probably benign Het
Col6a5 T A 9: 105,912,475 K1540* probably null Het
Csmd3 A T 15: 47,710,991 V1969E probably damaging Het
Dgka T G 10: 128,720,487 N710T probably damaging Het
Dock6 A G 9: 21,820,370 V1212A probably benign Het
En1 C T 1: 120,603,322 P97L unknown Het
Esd T A 14: 74,744,662 F172L probably damaging Het
Gfer C A 17: 24,695,968 D34Y probably damaging Het
Gm2832 G A 14: 41,279,739 M68I Het
Hmgcr A G 13: 96,658,910 S384P probably benign Het
Hsp90aa1 T C 12: 110,694,112 T299A possibly damaging Het
Igsf10 A G 3: 59,331,701 M353T probably benign Het
Ino80b T C 6: 83,122,325 T211A probably benign Het
Lamb2 C A 9: 108,489,488 T1607K probably benign Het
Lhfpl5 A G 17: 28,582,983 E218G probably benign Het
Lpo C A 11: 87,816,443 C248F probably damaging Het
Lrrc3 C T 10: 77,900,991 D204N probably damaging Het
Mavs C A 2: 131,243,131 L160I probably benign Het
Morn4 C T 19: 42,078,044 D35N possibly damaging Het
Mroh8 G A 2: 157,221,263 H813Y probably benign Het
Myf6 T C 10: 107,494,529 E59G probably damaging Het
Nlrp10 T A 7: 108,925,198 E358D possibly damaging Het
Olfr1009 T A 2: 85,721,608 F68I probably damaging Het
Olfr107 T C 17: 37,406,204 F219L probably benign Het
Olfr1120 A G 2: 87,357,722 T93A probably benign Het
Olfr396-ps1 T A 11: 73,928,506 L94* probably null Het
Olfr525 T C 7: 140,322,846 I49T possibly damaging Het
Olfr846 T C 9: 19,361,283 E24G possibly damaging Het
Optn T C 2: 5,052,837 probably null Het
Plxna4 T A 6: 32,192,269 H1331L probably damaging Het
Poli A T 18: 70,516,849 M357K possibly damaging Het
Psd4 T G 2: 24,394,543 C140G possibly damaging Het
Rab3gap1 T A 1: 127,891,098 probably null Het
Rasa3 T C 8: 13,631,826 N41S probably benign Het
S100a3 T A 3: 90,602,440 probably null Het
Sfrp5 T C 19: 42,201,765 K83E possibly damaging Het
Slco1a4 T C 6: 141,834,708 I119V probably benign Het
Snx15 T A 19: 6,120,596 Q271L probably damaging Het
Sorcs2 C A 5: 36,021,261 S1128I probably damaging Het
Tbc1d7 A T 13: 43,154,735 F85I probably damaging Het
Thoc7 A G 14: 13,953,528 Y46H probably damaging Het
Top1mt T A 15: 75,667,448 Y366F probably damaging Het
Trpv2 C A 11: 62,584,461 S233R probably benign Het
Vav1 C A 17: 57,279,268 T24N probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy4 G T 14: 32,964,626 probably null Het
Wdr3 A G 3: 100,154,997 S201P probably benign Het
Wdr34 A G 2: 30,038,266 V116A possibly damaging Het
Wfs1 C T 5: 36,966,950 D866N probably damaging Het
Wnk1 A T 6: 119,965,726 probably benign Het
Xpot G T 10: 121,602,399 Q762K probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Other mutations in Rps6kc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Rps6kc1 APN 1 190773678 missense probably damaging 1.00
IGL01310:Rps6kc1 APN 1 190783625 missense probably benign 0.45
IGL01331:Rps6kc1 APN 1 190800352 missense possibly damaging 0.49
IGL01551:Rps6kc1 APN 1 190773640 missense possibly damaging 0.70
IGL01665:Rps6kc1 APN 1 190911657 missense possibly damaging 0.66
IGL02178:Rps6kc1 APN 1 190871836 missense possibly damaging 0.63
IGL02550:Rps6kc1 APN 1 190871862 missense probably damaging 1.00
IGL02986:Rps6kc1 APN 1 190834061 missense probably damaging 1.00
IGL03010:Rps6kc1 APN 1 190911606 nonsense probably null
IGL03087:Rps6kc1 APN 1 190871711 missense probably damaging 1.00
IGL03130:Rps6kc1 APN 1 190799811 missense probably damaging 1.00
IGL03264:Rps6kc1 APN 1 190871829 missense probably benign
IGL03386:Rps6kc1 APN 1 190799570 missense probably damaging 0.97
R0184:Rps6kc1 UTSW 1 190799093 missense probably null 1.00
R0280:Rps6kc1 UTSW 1 190809000 missense probably damaging 1.00
R0482:Rps6kc1 UTSW 1 190799430 missense probably benign 0.00
R0651:Rps6kc1 UTSW 1 190799496 missense possibly damaging 0.51
R0785:Rps6kc1 UTSW 1 190808945 missense probably damaging 1.00
R1398:Rps6kc1 UTSW 1 190800015 missense probably damaging 0.99
R1428:Rps6kc1 UTSW 1 190798726 missense probably damaging 1.00
R1484:Rps6kc1 UTSW 1 190799475 missense possibly damaging 0.63
R1536:Rps6kc1 UTSW 1 190871768 missense possibly damaging 0.89
R1709:Rps6kc1 UTSW 1 190800336 missense possibly damaging 0.72
R2060:Rps6kc1 UTSW 1 190810108 missense possibly damaging 0.94
R2153:Rps6kc1 UTSW 1 190798723 missense probably damaging 1.00
R2871:Rps6kc1 UTSW 1 190899569 missense probably damaging 1.00
R2871:Rps6kc1 UTSW 1 190899569 missense probably damaging 1.00
R4177:Rps6kc1 UTSW 1 190800419 missense possibly damaging 0.92
R4231:Rps6kc1 UTSW 1 190808900 missense probably damaging 1.00
R4401:Rps6kc1 UTSW 1 190799958 missense probably benign 0.32
R4402:Rps6kc1 UTSW 1 190798605 intron probably benign
R4785:Rps6kc1 UTSW 1 190750188 missense probably benign 0.00
R4810:Rps6kc1 UTSW 1 190808963 missense probably damaging 1.00
R4858:Rps6kc1 UTSW 1 190800318 missense probably damaging 1.00
R4887:Rps6kc1 UTSW 1 190798694 missense probably benign 0.13
R4976:Rps6kc1 UTSW 1 190798727 missense probably damaging 0.99
R5134:Rps6kc1 UTSW 1 190773648 missense probably damaging 1.00
R5217:Rps6kc1 UTSW 1 190783605 missense probably damaging 1.00
R5350:Rps6kc1 UTSW 1 190799466 missense probably benign
R5952:Rps6kc1 UTSW 1 190885420 missense probably benign 0.05
R5979:Rps6kc1 UTSW 1 190800435 missense probably damaging 1.00
R6597:Rps6kc1 UTSW 1 190750184 missense probably benign 0.20
R7192:Rps6kc1 UTSW 1 190800359 missense probably damaging 0.98
R7423:Rps6kc1 UTSW 1 190799096 missense probably damaging 1.00
R7493:Rps6kc1 UTSW 1 190800057 missense probably benign 0.26
R7718:Rps6kc1 UTSW 1 190871825 missense probably benign 0.13
R7783:Rps6kc1 UTSW 1 190773654 missense probably benign 0.39
R7794:Rps6kc1 UTSW 1 190783628 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAATCCAGTCCCAGGAGCTC -3'
(R):5'- TCTCACCCCGAGTTCTCAAGAC -3'

Sequencing Primer
(F):5'- TCTGAAGAATTCCATAGGGCTG -3'
(R):5'- CGAGTTCTCAAGACGACAGC -3'
Posted On2019-05-13