Incidental Mutation 'R7024:Wdr34'
ID545822
Institutional Source Beutler Lab
Gene Symbol Wdr34
Ensembl Gene ENSMUSG00000039715
Gene NameWD repeat domain 34
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R7024 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location30031546-30048881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30038266 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 116 (V116A)
Ref Sequence ENSEMBL: ENSMUSP00000109340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113711]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113711
AA Change: V116A

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109340
Gene: ENSMUSG00000039715
AA Change: V116A

DomainStartEndE-ValueType
low complexity region 11 36 N/A INTRINSIC
low complexity region 90 100 N/A INTRINSIC
Blast:WD40 146 200 3e-28 BLAST
WD40 207 247 2e-1 SMART
WD40 256 300 3.42e1 SMART
Blast:WD40 323 364 8e-10 BLAST
WD40 382 422 1.66e-5 SMART
WD40 425 465 3.09e-1 SMART
WD40 470 512 4.18e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Defects in this gene are a cause of short-rib thoracic dysplasia 11 with or without polydactyly. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,220 S128P probably damaging Het
Abcc1 G C 16: 14,413,383 probably null Het
Armc4 A C 18: 7,211,593 D760E probably benign Het
Atg2a G A 19: 6,250,219 G686S possibly damaging Het
Atrnl1 A T 19: 57,638,450 probably null Het
Brd4 T C 17: 32,221,910 probably benign Het
C77080 T A 4: 129,225,408 E173V probably null Het
Camsap3 A G 8: 3,608,242 E688G probably damaging Het
Cc2d2a T A 5: 43,733,929 S1402R probably benign Het
Ccnb1 A G 13: 100,786,380 probably null Het
Cdc42bpb G A 12: 111,326,085 H339Y probably damaging Het
Ciart T A 3: 95,879,080 T94S probably benign Het
Col6a5 T A 9: 105,912,475 K1540* probably null Het
Csmd3 A T 15: 47,710,991 V1969E probably damaging Het
Dgka T G 10: 128,720,487 N710T probably damaging Het
Dock6 A G 9: 21,820,370 V1212A probably benign Het
En1 C T 1: 120,603,322 P97L unknown Het
Esd T A 14: 74,744,662 F172L probably damaging Het
Gfer C A 17: 24,695,968 D34Y probably damaging Het
Gm2832 G A 14: 41,279,739 M68I Het
Hmgcr A G 13: 96,658,910 S384P probably benign Het
Hsp90aa1 T C 12: 110,694,112 T299A possibly damaging Het
Igsf10 A G 3: 59,331,701 M353T probably benign Het
Ino80b T C 6: 83,122,325 T211A probably benign Het
Lamb2 C A 9: 108,489,488 T1607K probably benign Het
Lhfpl5 A G 17: 28,582,983 E218G probably benign Het
Lpo C A 11: 87,816,443 C248F probably damaging Het
Lrrc3 C T 10: 77,900,991 D204N probably damaging Het
Mavs C A 2: 131,243,131 L160I probably benign Het
Morn4 C T 19: 42,078,044 D35N possibly damaging Het
Mroh8 G A 2: 157,221,263 H813Y probably benign Het
Myf6 T C 10: 107,494,529 E59G probably damaging Het
Nlrp10 T A 7: 108,925,198 E358D possibly damaging Het
Olfr1009 T A 2: 85,721,608 F68I probably damaging Het
Olfr107 T C 17: 37,406,204 F219L probably benign Het
Olfr1120 A G 2: 87,357,722 T93A probably benign Het
Olfr396-ps1 T A 11: 73,928,506 L94* probably null Het
Olfr525 T C 7: 140,322,846 I49T possibly damaging Het
Olfr846 T C 9: 19,361,283 E24G possibly damaging Het
Optn T C 2: 5,052,837 probably null Het
Plxna4 T A 6: 32,192,269 H1331L probably damaging Het
Poli A T 18: 70,516,849 M357K possibly damaging Het
Psd4 T G 2: 24,394,543 C140G possibly damaging Het
Rab3gap1 T A 1: 127,891,098 probably null Het
Rasa3 T C 8: 13,631,826 N41S probably benign Het
Rps6kc1 A G 1: 190,800,210 S532P probably benign Het
S100a3 T A 3: 90,602,440 probably null Het
Sfrp5 T C 19: 42,201,765 K83E possibly damaging Het
Slco1a4 T C 6: 141,834,708 I119V probably benign Het
Snx15 T A 19: 6,120,596 Q271L probably damaging Het
Sorcs2 C A 5: 36,021,261 S1128I probably damaging Het
Tbc1d7 A T 13: 43,154,735 F85I probably damaging Het
Thoc7 A G 14: 13,953,528 Y46H probably damaging Het
Top1mt T A 15: 75,667,448 Y366F probably damaging Het
Trpv2 C A 11: 62,584,461 S233R probably benign Het
Vav1 C A 17: 57,279,268 T24N probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy4 G T 14: 32,964,626 probably null Het
Wdr3 A G 3: 100,154,997 S201P probably benign Het
Wfs1 C T 5: 36,966,950 D866N probably damaging Het
Wnk1 A T 6: 119,965,726 probably benign Het
Xpot G T 10: 121,602,399 Q762K probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Other mutations in Wdr34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02007:Wdr34 APN 2 30038390 missense probably benign 0.11
IGL02165:Wdr34 APN 2 30032160 missense probably benign
IGL02600:Wdr34 APN 2 30033302 missense possibly damaging 0.65
PIT1430001:Wdr34 UTSW 2 30032135 missense probably damaging 1.00
R0542:Wdr34 UTSW 2 30031825 missense probably damaging 0.98
R4065:Wdr34 UTSW 2 30032808 missense probably benign 0.03
R4067:Wdr34 UTSW 2 30032808 missense probably benign 0.03
R4750:Wdr34 UTSW 2 30033920 missense probably benign 0.00
R4907:Wdr34 UTSW 2 30032460 unclassified probably null
R5008:Wdr34 UTSW 2 30032769 missense probably benign 0.14
R5253:Wdr34 UTSW 2 30032363 unclassified probably benign
R6014:Wdr34 UTSW 2 30031751 missense probably benign 0.01
R6456:Wdr34 UTSW 2 30032767 missense probably benign 0.01
R6789:Wdr34 UTSW 2 30033272 critical splice donor site probably null
R7319:Wdr34 UTSW 2 30038329 missense probably benign 0.00
R7576:Wdr34 UTSW 2 30048778 missense probably benign 0.00
R7640:Wdr34 UTSW 2 30031768 missense probably benign 0.00
R8025:Wdr34 UTSW 2 30048718 missense probably benign 0.00
R8111:Wdr34 UTSW 2 30031847 missense possibly damaging 0.82
R8273:Wdr34 UTSW 2 30031891 missense probably damaging 1.00
R8277:Wdr34 UTSW 2 30033874 missense probably benign
R8309:Wdr34 UTSW 2 30032189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCCAGCTCTACACTCTC -3'
(R):5'- AATCTCCTTCCAGAAAAGTTGCCAG -3'

Sequencing Primer
(F):5'- GTACTACTGTCCCTCTGGTAGAG -3'
(R):5'- TTCCAGAAAAGTTGCCAGACAGC -3'
Posted On2019-05-13