Incidental Mutation 'R7024:Ino80b'
ID545835
Institutional Source Beutler Lab
Gene Symbol Ino80b
Ensembl Gene ENSMUSG00000030034
Gene NameINO80 complex subunit B
SynonymsPapa1, Znhit4, 2510009I23Rik, HMG1YL4, Hmga1l4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7024 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location83121765-83125431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83122325 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 211 (T211A)
Ref Sequence ENSEMBL: ENSMUSP00000109568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032109] [ENSMUST00000032111] [ENSMUST00000032114] [ENSMUST00000113935] [ENSMUST00000113936] [ENSMUST00000143814] [ENSMUST00000146328] [ENSMUST00000151393] [ENSMUST00000205023]
Predicted Effect probably benign
Transcript: ENSMUST00000032109
AA Change: T181A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000032109
Gene: ENSMUSG00000030034
AA Change: T181A

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
low complexity region 129 137 N/A INTRINSIC
low complexity region 161 177 N/A INTRINSIC
Pfam:PAPA-1 198 282 1.6e-27 PFAM
Pfam:zf-HIT 294 325 6.1e-10 PFAM
low complexity region 330 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032111
SMART Domains Protein: ENSMUSP00000032111
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 31 N/A INTRINSIC
Pfam:WBP-1 71 177 1.4e-50 PFAM
low complexity region 185 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032114
SMART Domains Protein: ENSMUSP00000032114
Gene: ENSMUSG00000030036

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
Pfam:Glyco_hydro_63N 91 267 1.1e-54 PFAM
Pfam:Glyco_hydro_63 349 832 7e-202 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113935
AA Change: T211A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000109568
Gene: ENSMUSG00000030034
AA Change: T211A

DomainStartEndE-ValueType
low complexity region 53 69 N/A INTRINSIC
low complexity region 159 167 N/A INTRINSIC
low complexity region 191 207 N/A INTRINSIC
Pfam:PAPA-1 228 309 4e-23 PFAM
Pfam:zf-HIT 324 355 4.3e-11 PFAM
low complexity region 360 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113936
SMART Domains Protein: ENSMUSP00000109569
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:WBP-1 36 142 1.2e-50 PFAM
low complexity region 150 165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131936
Predicted Effect probably benign
Transcript: ENSMUST00000143814
Predicted Effect probably benign
Transcript: ENSMUST00000146328
SMART Domains Protein: ENSMUSP00000122900
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:WBP-1 70 176 1.8e-50 PFAM
low complexity region 184 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151393
SMART Domains Protein: ENSMUSP00000145130
Gene: ENSMUSG00000030035

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 31 N/A INTRINSIC
Pfam:WBP-1 71 96 4.4e-6 PFAM
low complexity region 102 113 N/A INTRINSIC
low complexity region 171 189 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205023
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of an ATP-dependent chromatin remodeling complex, INO80, which plays a role in DNA and nucleosome-activated ATPase activity and ATP-dependent nucleosome sliding. Readthrough transcription of this gene into the neighboring downstream gene, which encodes WW domain-binding protein 1, generates a non-coding transcript. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,220 S128P probably damaging Het
Abcc1 G C 16: 14,413,383 probably null Het
Armc4 A C 18: 7,211,593 D760E probably benign Het
Atg2a G A 19: 6,250,219 G686S possibly damaging Het
Atrnl1 A T 19: 57,638,450 probably null Het
Brd4 T C 17: 32,221,910 probably benign Het
C77080 T A 4: 129,225,408 E173V probably null Het
Camsap3 A G 8: 3,608,242 E688G probably damaging Het
Cc2d2a T A 5: 43,733,929 S1402R probably benign Het
Ccnb1 A G 13: 100,786,380 probably null Het
Cdc42bpb G A 12: 111,326,085 H339Y probably damaging Het
Ciart T A 3: 95,879,080 T94S probably benign Het
Col6a5 T A 9: 105,912,475 K1540* probably null Het
Csmd3 A T 15: 47,710,991 V1969E probably damaging Het
Dgka T G 10: 128,720,487 N710T probably damaging Het
Dock6 A G 9: 21,820,370 V1212A probably benign Het
En1 C T 1: 120,603,322 P97L unknown Het
Esd T A 14: 74,744,662 F172L probably damaging Het
Gfer C A 17: 24,695,968 D34Y probably damaging Het
Gm2832 G A 14: 41,279,739 M68I Het
Hmgcr A G 13: 96,658,910 S384P probably benign Het
Hsp90aa1 T C 12: 110,694,112 T299A possibly damaging Het
Igsf10 A G 3: 59,331,701 M353T probably benign Het
Lamb2 C A 9: 108,489,488 T1607K probably benign Het
Lhfpl5 A G 17: 28,582,983 E218G probably benign Het
Lpo C A 11: 87,816,443 C248F probably damaging Het
Lrrc3 C T 10: 77,900,991 D204N probably damaging Het
Mavs C A 2: 131,243,131 L160I probably benign Het
Morn4 C T 19: 42,078,044 D35N possibly damaging Het
Mroh8 G A 2: 157,221,263 H813Y probably benign Het
Myf6 T C 10: 107,494,529 E59G probably damaging Het
Nlrp10 T A 7: 108,925,198 E358D possibly damaging Het
Olfr1009 T A 2: 85,721,608 F68I probably damaging Het
Olfr107 T C 17: 37,406,204 F219L probably benign Het
Olfr1120 A G 2: 87,357,722 T93A probably benign Het
Olfr396-ps1 T A 11: 73,928,506 L94* probably null Het
Olfr525 T C 7: 140,322,846 I49T possibly damaging Het
Olfr846 T C 9: 19,361,283 E24G possibly damaging Het
Optn T C 2: 5,052,837 probably null Het
Plxna4 T A 6: 32,192,269 H1331L probably damaging Het
Poli A T 18: 70,516,849 M357K possibly damaging Het
Psd4 T G 2: 24,394,543 C140G possibly damaging Het
Rab3gap1 T A 1: 127,891,098 probably null Het
Rasa3 T C 8: 13,631,826 N41S probably benign Het
Rps6kc1 A G 1: 190,800,210 S532P probably benign Het
S100a3 T A 3: 90,602,440 probably null Het
Sfrp5 T C 19: 42,201,765 K83E possibly damaging Het
Slco1a4 T C 6: 141,834,708 I119V probably benign Het
Snx15 T A 19: 6,120,596 Q271L probably damaging Het
Sorcs2 C A 5: 36,021,261 S1128I probably damaging Het
Tbc1d7 A T 13: 43,154,735 F85I probably damaging Het
Thoc7 A G 14: 13,953,528 Y46H probably damaging Het
Top1mt T A 15: 75,667,448 Y366F probably damaging Het
Trpv2 C A 11: 62,584,461 S233R probably benign Het
Vav1 C A 17: 57,279,268 T24N probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy4 G T 14: 32,964,626 probably null Het
Wdr3 A G 3: 100,154,997 S201P probably benign Het
Wdr34 A G 2: 30,038,266 V116A possibly damaging Het
Wfs1 C T 5: 36,966,950 D866N probably damaging Het
Wnk1 A T 6: 119,965,726 probably benign Het
Xpot G T 10: 121,602,399 Q762K probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Other mutations in Ino80b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Ino80b APN 6 83124148 missense probably damaging 1.00
IGL02063:Ino80b APN 6 83124162 missense probably damaging 0.99
R0310:Ino80b UTSW 6 83124091 missense probably damaging 1.00
R2022:Ino80b UTSW 6 83124372 missense probably damaging 0.98
R4051:Ino80b UTSW 6 83122333 missense probably damaging 1.00
R4052:Ino80b UTSW 6 83122333 missense probably damaging 1.00
R4114:Ino80b UTSW 6 83124140 missense probably benign 0.00
R4207:Ino80b UTSW 6 83122333 missense probably damaging 1.00
R4208:Ino80b UTSW 6 83122333 missense probably damaging 1.00
R4751:Ino80b UTSW 6 83124750 missense probably damaging 0.99
R5023:Ino80b UTSW 6 83125042 missense probably damaging 1.00
R6111:Ino80b UTSW 6 83124366 missense probably damaging 1.00
R6298:Ino80b UTSW 6 83125085 missense possibly damaging 0.92
R6467:Ino80b UTSW 6 83124131 unclassified probably null
X0023:Ino80b UTSW 6 83121952 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TAGCACTGTAGGCTGCAAAG -3'
(R):5'- TTTGGACCTGAGTGAGAGGC -3'

Sequencing Primer
(F):5'- TGCAGTAGCGCACCATG -3'
(R):5'- GTGGCACAAGCATTTGATCC -3'
Posted On2019-05-13