Incidental Mutation 'R7024:Olfr525'
ID545839
Institutional Source Beutler Lab
Gene Symbol Olfr525
Ensembl Gene ENSMUSG00000061489
Gene Nameolfactory receptor 525
SynonymsMOR251-2, GA_x6K02T2PBJ9-42472898-42473827
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R7024 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140320858-140327625 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140322846 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 49 (I49T)
Ref Sequence ENSEMBL: ENSMUSP00000149361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078103] [ENSMUST00000214594]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078103
AA Change: I49T

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000077243
Gene: ENSMUSG00000061489
AA Change: I49T

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.1e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 260 1.5e-5 PFAM
Pfam:7tm_1 41 290 1.3e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214594
AA Change: I49T

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,220 S128P probably damaging Het
Abcc1 G C 16: 14,413,383 probably null Het
Armc4 A C 18: 7,211,593 D760E probably benign Het
Atg2a G A 19: 6,250,219 G686S possibly damaging Het
Atrnl1 A T 19: 57,638,450 probably null Het
Brd4 T C 17: 32,221,910 probably benign Het
C77080 T A 4: 129,225,408 E173V probably null Het
Camsap3 A G 8: 3,608,242 E688G probably damaging Het
Cc2d2a T A 5: 43,733,929 S1402R probably benign Het
Ccnb1 A G 13: 100,786,380 probably null Het
Cdc42bpb G A 12: 111,326,085 H339Y probably damaging Het
Ciart T A 3: 95,879,080 T94S probably benign Het
Col6a5 T A 9: 105,912,475 K1540* probably null Het
Csmd3 A T 15: 47,710,991 V1969E probably damaging Het
Dgka T G 10: 128,720,487 N710T probably damaging Het
Dock6 A G 9: 21,820,370 V1212A probably benign Het
En1 C T 1: 120,603,322 P97L unknown Het
Esd T A 14: 74,744,662 F172L probably damaging Het
Gfer C A 17: 24,695,968 D34Y probably damaging Het
Gm2832 G A 14: 41,279,739 M68I Het
Hmgcr A G 13: 96,658,910 S384P probably benign Het
Hsp90aa1 T C 12: 110,694,112 T299A possibly damaging Het
Igsf10 A G 3: 59,331,701 M353T probably benign Het
Ino80b T C 6: 83,122,325 T211A probably benign Het
Lamb2 C A 9: 108,489,488 T1607K probably benign Het
Lhfpl5 A G 17: 28,582,983 E218G probably benign Het
Lpo C A 11: 87,816,443 C248F probably damaging Het
Lrrc3 C T 10: 77,900,991 D204N probably damaging Het
Mavs C A 2: 131,243,131 L160I probably benign Het
Morn4 C T 19: 42,078,044 D35N possibly damaging Het
Mroh8 G A 2: 157,221,263 H813Y probably benign Het
Myf6 T C 10: 107,494,529 E59G probably damaging Het
Nlrp10 T A 7: 108,925,198 E358D possibly damaging Het
Olfr1009 T A 2: 85,721,608 F68I probably damaging Het
Olfr107 T C 17: 37,406,204 F219L probably benign Het
Olfr1120 A G 2: 87,357,722 T93A probably benign Het
Olfr396-ps1 T A 11: 73,928,506 L94* probably null Het
Olfr846 T C 9: 19,361,283 E24G possibly damaging Het
Optn T C 2: 5,052,837 probably null Het
Plxna4 T A 6: 32,192,269 H1331L probably damaging Het
Poli A T 18: 70,516,849 M357K possibly damaging Het
Psd4 T G 2: 24,394,543 C140G possibly damaging Het
Rab3gap1 T A 1: 127,891,098 probably null Het
Rasa3 T C 8: 13,631,826 N41S probably benign Het
Rps6kc1 A G 1: 190,800,210 S532P probably benign Het
S100a3 T A 3: 90,602,440 probably null Het
Sfrp5 T C 19: 42,201,765 K83E possibly damaging Het
Slco1a4 T C 6: 141,834,708 I119V probably benign Het
Snx15 T A 19: 6,120,596 Q271L probably damaging Het
Sorcs2 C A 5: 36,021,261 S1128I probably damaging Het
Tbc1d7 A T 13: 43,154,735 F85I probably damaging Het
Thoc7 A G 14: 13,953,528 Y46H probably damaging Het
Top1mt T A 15: 75,667,448 Y366F probably damaging Het
Trpv2 C A 11: 62,584,461 S233R probably benign Het
Vav1 C A 17: 57,279,268 T24N probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy4 G T 14: 32,964,626 probably null Het
Wdr3 A G 3: 100,154,997 S201P probably benign Het
Wdr34 A G 2: 30,038,266 V116A possibly damaging Het
Wfs1 C T 5: 36,966,950 D866N probably damaging Het
Wnk1 A T 6: 119,965,726 probably benign Het
Xpot G T 10: 121,602,399 Q762K probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Other mutations in Olfr525
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02143:Olfr525 APN 7 140323592 nonsense probably null
IGL02450:Olfr525 APN 7 140323227 missense possibly damaging 0.95
IGL02927:Olfr525 APN 7 140322741 missense probably damaging 1.00
IGL03008:Olfr525 APN 7 140323532 missense probably damaging 1.00
IGL03202:Olfr525 APN 7 140323106 missense possibly damaging 0.96
R0268:Olfr525 UTSW 7 140323155 missense possibly damaging 0.63
R0612:Olfr525 UTSW 7 140323188 missense possibly damaging 0.63
R0751:Olfr525 UTSW 7 140323325 missense probably benign
R0801:Olfr525 UTSW 7 140322918 missense probably damaging 1.00
R0940:Olfr525 UTSW 7 140323152 missense probably benign 0.01
R2220:Olfr525 UTSW 7 140323571 missense probably benign 0.03
R3748:Olfr525 UTSW 7 140323128 missense possibly damaging 0.87
R4660:Olfr525 UTSW 7 140323412 missense possibly damaging 0.67
R4683:Olfr525 UTSW 7 140322768 missense probably benign 0.01
R4887:Olfr525 UTSW 7 140323101 missense probably benign
R4919:Olfr525 UTSW 7 140323514 nonsense probably null
R5097:Olfr525 UTSW 7 140323095 missense probably damaging 1.00
R5836:Olfr525 UTSW 7 140322914 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGTCACAGTAACTCCCAGGAC -3'
(R):5'- ATAGCGGTCATAGGCCATGG -3'

Sequencing Primer
(F):5'- TCCCAGGACTCACTCTCAAATGG -3'
(R):5'- TCATAGGCCATGGCAGTGAGC -3'
Posted On2019-05-13