Incidental Mutation 'R7024:Camsap3'
ID545840
Institutional Source Beutler Lab
Gene Symbol Camsap3
Ensembl Gene ENSMUSG00000044433
Gene Namecalmodulin regulated spectrin-associated protein family, member 3
SynonymsNezha, 2310057J16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R7024 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location3587293-3609075 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3608242 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 688 (E688G)
Ref Sequence ENSEMBL: ENSMUSP00000146359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019614] [ENSMUST00000057028] [ENSMUST00000171962] [ENSMUST00000207077] [ENSMUST00000207432] [ENSMUST00000207533] [ENSMUST00000207712] [ENSMUST00000207970] [ENSMUST00000208240]
Predicted Effect probably benign
Transcript: ENSMUST00000019614
SMART Domains Protein: ENSMUSP00000019614
Gene: ENSMUSG00000019470

DomainStartEndE-ValueType
HAT 48 80 7.56e0 SMART
HAT 93 122 1.92e2 SMART
HAT 124 158 4.89e-2 SMART
HAT 270 305 3.82e-4 SMART
low complexity region 316 333 N/A INTRINSIC
HAT 409 445 1.88e1 SMART
HAT 447 496 2.32e2 SMART
HAT 498 530 1.56e1 SMART
HAT 532 566 5.84e0 SMART
HAT 571 605 3.62e-5 SMART
Blast:HAT 607 641 3e-14 BLAST
Blast:HAT 643 677 2e-15 BLAST
HAT 679 713 2.77e-1 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 823 836 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057028
AA Change: E1092G

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000058958
Gene: ENSMUSG00000044433
AA Change: E1092G

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CH 166 315 5.5e-27 PFAM
Pfam:CAMSAP_CH 214 296 1.2e-29 PFAM
low complexity region 359 373 N/A INTRINSIC
coiled coil region 595 633 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
coiled coil region 696 727 N/A INTRINSIC
low complexity region 749 779 N/A INTRINSIC
low complexity region 828 837 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
coiled coil region 900 943 N/A INTRINSIC
low complexity region 944 965 N/A INTRINSIC
low complexity region 1002 1024 N/A INTRINSIC
CAMSAP_CKK 1111 1240 1.29e-86 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171962
AA Change: E1093G

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125993
Gene: ENSMUSG00000044433
AA Change: E1093G

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CAMSAP_CH 214 296 6e-31 PFAM
low complexity region 360 374 N/A INTRINSIC
Pfam:CAMSAP_CC1 587 645 1.1e-27 PFAM
low complexity region 646 656 N/A INTRINSIC
coiled coil region 697 728 N/A INTRINSIC
low complexity region 750 780 N/A INTRINSIC
low complexity region 829 838 N/A INTRINSIC
low complexity region 867 882 N/A INTRINSIC
coiled coil region 901 944 N/A INTRINSIC
low complexity region 945 966 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
CAMSAP_CKK 1112 1241 1.29e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207077
AA Change: E1108G

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000207152
Predicted Effect probably benign
Transcript: ENSMUST00000207432
AA Change: E1119G

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably damaging
Transcript: ENSMUST00000207533
AA Change: E692G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000207712
AA Change: E677G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207970
AA Change: E1103G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000208240
AA Change: E688G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.1568 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (61/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display variable penetrance of vascular, liver, nervous system, rib and eye abnormalities. Mice homozygous for an allele with loss of microtubule binding show partial lethality, decreased body size and abnormal alignment of microtubles in polarized epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,220 S128P probably damaging Het
Abcc1 G C 16: 14,413,383 probably null Het
Armc4 A C 18: 7,211,593 D760E probably benign Het
Atg2a G A 19: 6,250,219 G686S possibly damaging Het
Atrnl1 A T 19: 57,638,450 probably null Het
Brd4 T C 17: 32,221,910 probably benign Het
C77080 T A 4: 129,225,408 E173V probably null Het
Cc2d2a T A 5: 43,733,929 S1402R probably benign Het
Ccnb1 A G 13: 100,786,380 probably null Het
Cdc42bpb G A 12: 111,326,085 H339Y probably damaging Het
Ciart T A 3: 95,879,080 T94S probably benign Het
Col6a5 T A 9: 105,912,475 K1540* probably null Het
Csmd3 A T 15: 47,710,991 V1969E probably damaging Het
Dgka T G 10: 128,720,487 N710T probably damaging Het
Dock6 A G 9: 21,820,370 V1212A probably benign Het
En1 C T 1: 120,603,322 P97L unknown Het
Esd T A 14: 74,744,662 F172L probably damaging Het
Gfer C A 17: 24,695,968 D34Y probably damaging Het
Gm2832 G A 14: 41,279,739 M68I Het
Hmgcr A G 13: 96,658,910 S384P probably benign Het
Hsp90aa1 T C 12: 110,694,112 T299A possibly damaging Het
Igsf10 A G 3: 59,331,701 M353T probably benign Het
Ino80b T C 6: 83,122,325 T211A probably benign Het
Lamb2 C A 9: 108,489,488 T1607K probably benign Het
Lhfpl5 A G 17: 28,582,983 E218G probably benign Het
Lpo C A 11: 87,816,443 C248F probably damaging Het
Lrrc3 C T 10: 77,900,991 D204N probably damaging Het
Mavs C A 2: 131,243,131 L160I probably benign Het
Morn4 C T 19: 42,078,044 D35N possibly damaging Het
Mroh8 G A 2: 157,221,263 H813Y probably benign Het
Myf6 T C 10: 107,494,529 E59G probably damaging Het
Nlrp10 T A 7: 108,925,198 E358D possibly damaging Het
Olfr1009 T A 2: 85,721,608 F68I probably damaging Het
Olfr107 T C 17: 37,406,204 F219L probably benign Het
Olfr1120 A G 2: 87,357,722 T93A probably benign Het
Olfr396-ps1 T A 11: 73,928,506 L94* probably null Het
Olfr525 T C 7: 140,322,846 I49T possibly damaging Het
Olfr846 T C 9: 19,361,283 E24G possibly damaging Het
Optn T C 2: 5,052,837 probably null Het
Plxna4 T A 6: 32,192,269 H1331L probably damaging Het
Poli A T 18: 70,516,849 M357K possibly damaging Het
Psd4 T G 2: 24,394,543 C140G possibly damaging Het
Rab3gap1 T A 1: 127,891,098 probably null Het
Rasa3 T C 8: 13,631,826 N41S probably benign Het
Rps6kc1 A G 1: 190,800,210 S532P probably benign Het
S100a3 T A 3: 90,602,440 probably null Het
Sfrp5 T C 19: 42,201,765 K83E possibly damaging Het
Slco1a4 T C 6: 141,834,708 I119V probably benign Het
Snx15 T A 19: 6,120,596 Q271L probably damaging Het
Sorcs2 C A 5: 36,021,261 S1128I probably damaging Het
Tbc1d7 A T 13: 43,154,735 F85I probably damaging Het
Thoc7 A G 14: 13,953,528 Y46H probably damaging Het
Top1mt T A 15: 75,667,448 Y366F probably damaging Het
Trpv2 C A 11: 62,584,461 S233R probably benign Het
Vav1 C A 17: 57,279,268 T24N probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy4 G T 14: 32,964,626 probably null Het
Wdr3 A G 3: 100,154,997 S201P probably benign Het
Wdr34 A G 2: 30,038,266 V116A possibly damaging Het
Wfs1 C T 5: 36,966,950 D866N probably damaging Het
Wnk1 A T 6: 119,965,726 probably benign Het
Xpot G T 10: 121,602,399 Q762K probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Other mutations in Camsap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Camsap3 APN 8 3602077 missense probably damaging 1.00
IGL00797:Camsap3 APN 8 3602115 splice site probably benign
IGL01457:Camsap3 APN 8 3604795 missense probably damaging 0.98
IGL01833:Camsap3 APN 8 3608508 missense probably damaging 1.00
IGL02095:Camsap3 APN 8 3603845 missense probably damaging 1.00
IGL02880:Camsap3 APN 8 3603913 missense probably damaging 1.00
R0005:Camsap3 UTSW 8 3604288 missense probably damaging 1.00
R0049:Camsap3 UTSW 8 3598772 missense probably benign 0.11
R0049:Camsap3 UTSW 8 3598772 missense probably benign 0.11
R0347:Camsap3 UTSW 8 3602029 missense probably damaging 1.00
R0926:Camsap3 UTSW 8 3587960 critical splice donor site probably null
R0946:Camsap3 UTSW 8 3604442 missense probably benign 0.00
R1169:Camsap3 UTSW 8 3603866 missense probably damaging 1.00
R1206:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1454:Camsap3 UTSW 8 3603968 missense possibly damaging 0.58
R1475:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1581:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1618:Camsap3 UTSW 8 3598740 missense probably benign 0.25
R1820:Camsap3 UTSW 8 3603485 missense probably damaging 1.00
R1899:Camsap3 UTSW 8 3603922 nonsense probably null
R1914:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1952:Camsap3 UTSW 8 3604789 missense probably damaging 0.99
R2338:Camsap3 UTSW 8 3606808 missense probably damaging 1.00
R3725:Camsap3 UTSW 8 3603785 missense probably damaging 1.00
R3726:Camsap3 UTSW 8 3603785 missense probably damaging 1.00
R4528:Camsap3 UTSW 8 3606515 missense possibly damaging 0.79
R4652:Camsap3 UTSW 8 3600689 missense possibly damaging 0.87
R5025:Camsap3 UTSW 8 3604244 missense probably damaging 1.00
R5120:Camsap3 UTSW 8 3600680 missense probably damaging 0.97
R5381:Camsap3 UTSW 8 3603812 missense probably damaging 1.00
R5388:Camsap3 UTSW 8 3604276 missense probably damaging 1.00
R5829:Camsap3 UTSW 8 3597899 missense probably damaging 1.00
R5846:Camsap3 UTSW 8 3603980 missense probably damaging 1.00
R5935:Camsap3 UTSW 8 3601999 missense probably damaging 1.00
R6363:Camsap3 UTSW 8 3601971 missense probably damaging 1.00
R6469:Camsap3 UTSW 8 3603941 missense possibly damaging 0.79
R6595:Camsap3 UTSW 8 3604186 missense probably damaging 1.00
R6595:Camsap3 UTSW 8 3608742 missense probably damaging 1.00
R7062:Camsap3 UTSW 8 3607834 unclassified probably benign
R7109:Camsap3 UTSW 8 3598087 missense possibly damaging 0.53
R7233:Camsap3 UTSW 8 3600371 missense probably damaging 0.99
R7236:Camsap3 UTSW 8 3604116 missense probably damaging 1.00
R7316:Camsap3 UTSW 8 3604648 missense possibly damaging 0.51
R7340:Camsap3 UTSW 8 3587960 critical splice donor site probably null
R7512:Camsap3 UTSW 8 3598740 missense probably benign 0.25
R7779:Camsap3 UTSW 8 3597887 missense probably damaging 1.00
R8134:Camsap3 UTSW 8 3598075 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGAGCAGCTGTCTATGGAC -3'
(R):5'- AACTTGTTAGACTTGGCGCTGG -3'

Sequencing Primer
(F):5'- CTATGGACTTGTGGCAGCATGC -3'
(R):5'- CGCTGGGTTCCTTGTATAGCC -3'
Posted On2019-05-13