Incidental Mutation 'R7024:Dock6'
ID545843
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Namededicator of cytokinesis 6
Synonyms2410095B20Rik, C330023D02Rik, 4931431C02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.547) question?
Stock #R7024 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location21799860-21852635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21820370 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1212 (V1212A)
Ref Sequence ENSEMBL: ENSMUSP00000149156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034728] [ENSMUST00000217336]
Predicted Effect probably benign
Transcript: ENSMUST00000034728
AA Change: V1181A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198
AA Change: V1181A

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215729
Predicted Effect probably benign
Transcript: ENSMUST00000216626
Predicted Effect probably benign
Transcript: ENSMUST00000217336
AA Change: V1212A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,220 S128P probably damaging Het
Abcc1 G C 16: 14,413,383 probably null Het
Armc4 A C 18: 7,211,593 D760E probably benign Het
Atg2a G A 19: 6,250,219 G686S possibly damaging Het
Atrnl1 A T 19: 57,638,450 probably null Het
Brd4 T C 17: 32,221,910 probably benign Het
C77080 T A 4: 129,225,408 E173V probably null Het
Camsap3 A G 8: 3,608,242 E688G probably damaging Het
Cc2d2a T A 5: 43,733,929 S1402R probably benign Het
Ccnb1 A G 13: 100,786,380 probably null Het
Cdc42bpb G A 12: 111,326,085 H339Y probably damaging Het
Ciart T A 3: 95,879,080 T94S probably benign Het
Col6a5 T A 9: 105,912,475 K1540* probably null Het
Csmd3 A T 15: 47,710,991 V1969E probably damaging Het
Dgka T G 10: 128,720,487 N710T probably damaging Het
En1 C T 1: 120,603,322 P97L unknown Het
Esd T A 14: 74,744,662 F172L probably damaging Het
Gfer C A 17: 24,695,968 D34Y probably damaging Het
Gm2832 G A 14: 41,279,739 M68I Het
Hmgcr A G 13: 96,658,910 S384P probably benign Het
Hsp90aa1 T C 12: 110,694,112 T299A possibly damaging Het
Igsf10 A G 3: 59,331,701 M353T probably benign Het
Ino80b T C 6: 83,122,325 T211A probably benign Het
Lamb2 C A 9: 108,489,488 T1607K probably benign Het
Lhfpl5 A G 17: 28,582,983 E218G probably benign Het
Lpo C A 11: 87,816,443 C248F probably damaging Het
Lrrc3 C T 10: 77,900,991 D204N probably damaging Het
Mavs C A 2: 131,243,131 L160I probably benign Het
Morn4 C T 19: 42,078,044 D35N possibly damaging Het
Mroh8 G A 2: 157,221,263 H813Y probably benign Het
Myf6 T C 10: 107,494,529 E59G probably damaging Het
Nlrp10 T A 7: 108,925,198 E358D possibly damaging Het
Olfr1009 T A 2: 85,721,608 F68I probably damaging Het
Olfr107 T C 17: 37,406,204 F219L probably benign Het
Olfr1120 A G 2: 87,357,722 T93A probably benign Het
Olfr396-ps1 T A 11: 73,928,506 L94* probably null Het
Olfr525 T C 7: 140,322,846 I49T possibly damaging Het
Olfr846 T C 9: 19,361,283 E24G possibly damaging Het
Optn T C 2: 5,052,837 probably null Het
Plxna4 T A 6: 32,192,269 H1331L probably damaging Het
Poli A T 18: 70,516,849 M357K possibly damaging Het
Psd4 T G 2: 24,394,543 C140G possibly damaging Het
Rab3gap1 T A 1: 127,891,098 probably null Het
Rasa3 T C 8: 13,631,826 N41S probably benign Het
Rps6kc1 A G 1: 190,800,210 S532P probably benign Het
S100a3 T A 3: 90,602,440 probably null Het
Sfrp5 T C 19: 42,201,765 K83E possibly damaging Het
Slco1a4 T C 6: 141,834,708 I119V probably benign Het
Snx15 T A 19: 6,120,596 Q271L probably damaging Het
Sorcs2 C A 5: 36,021,261 S1128I probably damaging Het
Tbc1d7 A T 13: 43,154,735 F85I probably damaging Het
Thoc7 A G 14: 13,953,528 Y46H probably damaging Het
Top1mt T A 15: 75,667,448 Y366F probably damaging Het
Trpv2 C A 11: 62,584,461 S233R probably benign Het
Vav1 C A 17: 57,279,268 T24N probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy4 G T 14: 32,964,626 probably null Het
Wdr3 A G 3: 100,154,997 S201P probably benign Het
Wdr34 A G 2: 30,038,266 V116A possibly damaging Het
Wfs1 C T 5: 36,966,950 D866N probably damaging Het
Wnk1 A T 6: 119,965,726 probably benign Het
Xpot G T 10: 121,602,399 Q762K probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21846634 missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21811807 missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21803045 missense probably damaging 1.00
IGL02025:Dock6 APN 9 21809589 missense probably damaging 0.98
IGL02028:Dock6 APN 9 21838826 missense probably damaging 1.00
IGL02311:Dock6 APN 9 21844328 missense probably damaging 1.00
IGL02441:Dock6 APN 9 21841926 missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21846655 missense probably benign 0.19
IGL02516:Dock6 APN 9 21802585 missense probably damaging 1.00
IGL02836:Dock6 APN 9 21801864 missense probably damaging 1.00
IGL02894:Dock6 APN 9 21811815 missense probably damaging 1.00
bayfront UTSW 9 21821745 missense probably benign 0.29
IGL03048:Dock6 UTSW 9 21809570 missense probably damaging 1.00
R0370:Dock6 UTSW 9 21814565 missense probably benign 0.29
R0504:Dock6 UTSW 9 21802436 missense probably damaging 1.00
R0633:Dock6 UTSW 9 21844417 missense probably benign 0.00
R0634:Dock6 UTSW 9 21841527 missense probably damaging 1.00
R0671:Dock6 UTSW 9 21804627 splice site probably benign
R0839:Dock6 UTSW 9 21817892 missense probably benign 0.01
R0948:Dock6 UTSW 9 21801533 missense probably damaging 1.00
R1022:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1024:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1073:Dock6 UTSW 9 21846518 missense probably benign
R1463:Dock6 UTSW 9 21831906 missense probably damaging 1.00
R1481:Dock6 UTSW 9 21820622 missense probably benign
R1494:Dock6 UTSW 9 21814742 missense probably benign 0.34
R1547:Dock6 UTSW 9 21814588 missense probably damaging 1.00
R1654:Dock6 UTSW 9 21804843 missense probably damaging 0.98
R1782:Dock6 UTSW 9 21811846 missense probably damaging 1.00
R1905:Dock6 UTSW 9 21829574 missense probably benign 0.37
R1908:Dock6 UTSW 9 21841629 missense probably damaging 1.00
R1916:Dock6 UTSW 9 21813091 missense probably damaging 1.00
R2132:Dock6 UTSW 9 21846518 missense probably benign
R2197:Dock6 UTSW 9 21832881 missense probably damaging 1.00
R2316:Dock6 UTSW 9 21839677 missense probably damaging 0.98
R2341:Dock6 UTSW 9 21839486 splice site probably benign
R2519:Dock6 UTSW 9 21816333 missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21809630 missense probably damaging 1.00
R2939:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21845754 splice site probably benign
R3081:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3810:Dock6 UTSW 9 21801577 missense probably damaging 1.00
R4246:Dock6 UTSW 9 21839490 splice site probably null
R4604:Dock6 UTSW 9 21802540 missense probably damaging 1.00
R4833:Dock6 UTSW 9 21844280 missense probably damaging 1.00
R4849:Dock6 UTSW 9 21811772 critical splice donor site probably null
R4896:Dock6 UTSW 9 21824437 missense possibly damaging 0.48
R4926:Dock6 UTSW 9 21845791 missense probably damaging 1.00
R5183:Dock6 UTSW 9 21841603 missense probably benign 0.00
R5211:Dock6 UTSW 9 21820352 missense probably benign 0.36
R5337:Dock6 UTSW 9 21829548 missense possibly damaging 0.93
R5353:Dock6 UTSW 9 21814786 missense probably benign 0.00
R5429:Dock6 UTSW 9 21832881 missense probably damaging 0.99
R5463:Dock6 UTSW 9 21809958 intron probably null
R5476:Dock6 UTSW 9 21809589 missense probably damaging 0.98
R5511:Dock6 UTSW 9 21817407 missense possibly damaging 0.59
R5534:Dock6 UTSW 9 21803076 nonsense probably null
R5718:Dock6 UTSW 9 21824493 missense probably benign 0.11
R5823:Dock6 UTSW 9 21804828 missense probably damaging 0.99
R5831:Dock6 UTSW 9 21803036 missense probably damaging 1.00
R5887:Dock6 UTSW 9 21820394 missense probably damaging 0.96
R5930:Dock6 UTSW 9 21824416 missense probably benign 0.29
R6159:Dock6 UTSW 9 21821745 missense probably benign 0.29
R6633:Dock6 UTSW 9 21820331 missense probably benign 0.17
R6633:Dock6 UTSW 9 21821503 missense probably damaging 1.00
R6665:Dock6 UTSW 9 21839912 missense probably damaging 0.99
R6744:Dock6 UTSW 9 21831474 missense probably damaging 1.00
R6903:Dock6 UTSW 9 21809564 missense probably damaging 1.00
R6981:Dock6 UTSW 9 21845550 missense probably damaging 0.99
R7030:Dock6 UTSW 9 21813079 missense probably damaging 1.00
R7045:Dock6 UTSW 9 21821811 missense probably damaging 1.00
R7139:Dock6 UTSW 9 21801276 missense probably damaging 1.00
R7356:Dock6 UTSW 9 21809899 missense probably damaging 1.00
R7400:Dock6 UTSW 9 21801807 missense possibly damaging 0.62
R7847:Dock6 UTSW 9 21801207 missense unknown
R7863:Dock6 UTSW 9 21846658 missense possibly damaging 0.85
R7930:Dock6 UTSW 9 21801207 missense unknown
R7946:Dock6 UTSW 9 21846658 missense possibly damaging 0.85
R8012:Dock6 UTSW 9 21846511 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TAGACACTGTGGTGAGTCTGGC -3'
(R):5'- CGAAGGTGACCAGCATGTTC -3'

Sequencing Primer
(F):5'- TGAGTCTGGCCCAAGCTG -3'
(R):5'- TGACCAGCATGTTCGAGCTGAG -3'
Posted On2019-05-13