Incidental Mutation 'R7024:Xpot'
ID545848
Institutional Source Beutler Lab
Gene Symbol Xpot
Ensembl Gene ENSMUSG00000034667
Gene Nameexportin, tRNA (nuclear export receptor for tRNAs)
Synonyms1110004L07Rik, C79645, EXPORTIN-T
MMRRC Submission
Accession Numbers

Genbank: NM_001081056; MGI: 1920442

Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R7024 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location121587380-121626332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 121602399 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 762 (Q762K)
Ref Sequence ENSEMBL: ENSMUSP00000151722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039810] [ENSMUST00000218004]
Predicted Effect probably benign
Transcript: ENSMUST00000039810
AA Change: Q763K

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000043488
Gene: ENSMUSG00000034667
AA Change: Q763K

DomainStartEndE-ValueType
IBN_N 21 89 1.37e-3 SMART
Pfam:Xpo1 98 248 5.1e-42 PFAM
low complexity region 386 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218004
AA Change: Q762K

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000219334
Meta Mutation Damage Score 0.0944 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the RAN-GTPase exportin family that mediates export of tRNA from the nucleus to the cytoplasm. Translocation of tRNA to the cytoplasm occurs once exportin has bound both tRNA and GTP-bound RAN. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(22) : Targeted, other(2) Gene trapped(20)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,220 S128P probably damaging Het
Abcc1 G C 16: 14,413,383 probably null Het
Armc4 A C 18: 7,211,593 D760E probably benign Het
Atg2a G A 19: 6,250,219 G686S possibly damaging Het
Atrnl1 A T 19: 57,638,450 probably null Het
Brd4 T C 17: 32,221,910 probably benign Het
C77080 T A 4: 129,225,408 E173V probably null Het
Camsap3 A G 8: 3,608,242 E688G probably damaging Het
Cc2d2a T A 5: 43,733,929 S1402R probably benign Het
Ccnb1 A G 13: 100,786,380 probably null Het
Cdc42bpb G A 12: 111,326,085 H339Y probably damaging Het
Ciart T A 3: 95,879,080 T94S probably benign Het
Col6a5 T A 9: 105,912,475 K1540* probably null Het
Csmd3 A T 15: 47,710,991 V1969E probably damaging Het
Dgka T G 10: 128,720,487 N710T probably damaging Het
Dock6 A G 9: 21,820,370 V1212A probably benign Het
En1 C T 1: 120,603,322 P97L unknown Het
Esd T A 14: 74,744,662 F172L probably damaging Het
Gfer C A 17: 24,695,968 D34Y probably damaging Het
Gm2832 G A 14: 41,279,739 M68I Het
Hmgcr A G 13: 96,658,910 S384P probably benign Het
Hsp90aa1 T C 12: 110,694,112 T299A possibly damaging Het
Igsf10 A G 3: 59,331,701 M353T probably benign Het
Ino80b T C 6: 83,122,325 T211A probably benign Het
Lamb2 C A 9: 108,489,488 T1607K probably benign Het
Lhfpl5 A G 17: 28,582,983 E218G probably benign Het
Lpo C A 11: 87,816,443 C248F probably damaging Het
Lrrc3 C T 10: 77,900,991 D204N probably damaging Het
Mavs C A 2: 131,243,131 L160I probably benign Het
Morn4 C T 19: 42,078,044 D35N possibly damaging Het
Mroh8 G A 2: 157,221,263 H813Y probably benign Het
Myf6 T C 10: 107,494,529 E59G probably damaging Het
Nlrp10 T A 7: 108,925,198 E358D possibly damaging Het
Olfr1009 T A 2: 85,721,608 F68I probably damaging Het
Olfr107 T C 17: 37,406,204 F219L probably benign Het
Olfr1120 A G 2: 87,357,722 T93A probably benign Het
Olfr396-ps1 T A 11: 73,928,506 L94* probably null Het
Olfr525 T C 7: 140,322,846 I49T possibly damaging Het
Olfr846 T C 9: 19,361,283 E24G possibly damaging Het
Optn T C 2: 5,052,837 probably null Het
Plxna4 T A 6: 32,192,269 H1331L probably damaging Het
Poli A T 18: 70,516,849 M357K possibly damaging Het
Psd4 T G 2: 24,394,543 C140G possibly damaging Het
Rab3gap1 T A 1: 127,891,098 probably null Het
Rasa3 T C 8: 13,631,826 N41S probably benign Het
Rps6kc1 A G 1: 190,800,210 S532P probably benign Het
S100a3 T A 3: 90,602,440 probably null Het
Sfrp5 T C 19: 42,201,765 K83E possibly damaging Het
Slco1a4 T C 6: 141,834,708 I119V probably benign Het
Snx15 T A 19: 6,120,596 Q271L probably damaging Het
Sorcs2 C A 5: 36,021,261 S1128I probably damaging Het
Tbc1d7 A T 13: 43,154,735 F85I probably damaging Het
Thoc7 A G 14: 13,953,528 Y46H probably damaging Het
Top1mt T A 15: 75,667,448 Y366F probably damaging Het
Trpv2 C A 11: 62,584,461 S233R probably benign Het
Vav1 C A 17: 57,279,268 T24N probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy4 G T 14: 32,964,626 probably null Het
Wdr3 A G 3: 100,154,997 S201P probably benign Het
Wdr34 A G 2: 30,038,266 V116A possibly damaging Het
Wfs1 C T 5: 36,966,950 D866N probably damaging Het
Wnk1 A T 6: 119,965,726 probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Other mutations in Xpot
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Xpot APN 10 121605644 missense probably benign
IGL01286:Xpot APN 10 121602338 missense probably benign 0.03
IGL01364:Xpot APN 10 121604494 missense probably benign 0.08
IGL01370:Xpot APN 10 121604494 missense probably benign 0.08
IGL01516:Xpot APN 10 121590222 unclassified probably null
IGL01530:Xpot APN 10 121611528 missense probably damaging 0.99
IGL02047:Xpot APN 10 121601362 unclassified probably benign
IGL02207:Xpot APN 10 121613580 missense probably damaging 1.00
IGL02340:Xpot APN 10 121615204 missense probably damaging 1.00
IGL02408:Xpot APN 10 121603165 missense probably damaging 1.00
IGL03150:Xpot APN 10 121609186 missense probably benign 0.00
IGL03210:Xpot APN 10 121615227 splice site probably benign
3-1:Xpot UTSW 10 121613359 missense probably benign 0.00
R0077:Xpot UTSW 10 121605639 missense probably benign 0.09
R1750:Xpot UTSW 10 121603027 critical splice donor site probably null
R1806:Xpot UTSW 10 121607638 splice site probably benign
R1950:Xpot UTSW 10 121619148 missense probably benign
R2227:Xpot UTSW 10 121622860 missense probably damaging 0.98
R2304:Xpot UTSW 10 121611583 missense probably benign 0.02
R3914:Xpot UTSW 10 121604538 missense possibly damaging 0.72
R4784:Xpot UTSW 10 121615063 unclassified probably null
R4884:Xpot UTSW 10 121606808 missense probably damaging 1.00
R4904:Xpot UTSW 10 121617178 missense probably benign 0.00
R5218:Xpot UTSW 10 121619138 missense probably damaging 0.99
R5361:Xpot UTSW 10 121600860 missense possibly damaging 0.71
R5651:Xpot UTSW 10 121604549 missense probably damaging 0.99
R5894:Xpot UTSW 10 121613646 missense probably damaging 1.00
R5915:Xpot UTSW 10 121615093 missense probably damaging 0.97
R6139:Xpot UTSW 10 121611708 missense probably benign 0.41
R6182:Xpot UTSW 10 121606258 missense probably damaging 1.00
R6896:Xpot UTSW 10 121613485 critical splice donor site probably null
R7146:Xpot UTSW 10 121606773 missense probably damaging 1.00
R7272:Xpot UTSW 10 121617189 critical splice acceptor site probably null
R7556:Xpot UTSW 10 121613506 missense probably benign 0.01
R7882:Xpot UTSW 10 121619091 critical splice donor site probably null
R7965:Xpot UTSW 10 121619091 critical splice donor site probably null
R8087:Xpot UTSW 10 121601327 missense probably benign
R8224:Xpot UTSW 10 121607608 missense probably damaging 1.00
R8303:Xpot UTSW 10 121611500 nonsense probably null
Z1088:Xpot UTSW 10 121601323 missense probably damaging 0.99
Z1176:Xpot UTSW 10 121617174 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACACCCTACCTTGATTCG -3'
(R):5'- TGACCACTTGTTACTTCTCAAATCG -3'

Sequencing Primer
(F):5'- GATTCGCGATCACTTCACTCATC -3'
(R):5'- ACAGTATGTGTGTCAGCCTAC -3'
Posted On2019-05-13