Incidental Mutation 'R7024:Lpo'
ID545853
Institutional Source Beutler Lab
Gene Symbol Lpo
Ensembl Gene ENSMUSG00000009356
Gene Namelactoperoxidase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7024 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location87806428-87828289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87816443 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 248 (C248F)
Ref Sequence ENSEMBL: ENSMUSP00000099466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103177] [ENSMUST00000136446]
Predicted Effect probably damaging
Transcript: ENSMUST00000103177
AA Change: C248F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099466
Gene: ENSMUSG00000009356
AA Change: C248F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:An_peroxidase 136 682 1.8e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136446
SMART Domains Protein: ENSMUSP00000117763
Gene: ENSMUSG00000009356

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4OEK|A 116 145 4e-7 PDB
SCOP:g1cxp.1 130 145 1e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peroxidase family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. Following its secretion from salivary, mammary, and other mucosal glands, this enzyme catalyzes the generation of the antimicrobial substance hypothiocyanous acid. This gene is present in a gene cluster on chromosome 17. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,220 S128P probably damaging Het
Abcc1 G C 16: 14,413,383 probably null Het
Armc4 A C 18: 7,211,593 D760E probably benign Het
Atg2a G A 19: 6,250,219 G686S possibly damaging Het
Atrnl1 A T 19: 57,638,450 probably null Het
Brd4 T C 17: 32,221,910 probably benign Het
C77080 T A 4: 129,225,408 E173V probably null Het
Camsap3 A G 8: 3,608,242 E688G probably damaging Het
Cc2d2a T A 5: 43,733,929 S1402R probably benign Het
Ccnb1 A G 13: 100,786,380 probably null Het
Cdc42bpb G A 12: 111,326,085 H339Y probably damaging Het
Ciart T A 3: 95,879,080 T94S probably benign Het
Col6a5 T A 9: 105,912,475 K1540* probably null Het
Csmd3 A T 15: 47,710,991 V1969E probably damaging Het
Dgka T G 10: 128,720,487 N710T probably damaging Het
Dock6 A G 9: 21,820,370 V1212A probably benign Het
En1 C T 1: 120,603,322 P97L unknown Het
Esd T A 14: 74,744,662 F172L probably damaging Het
Gfer C A 17: 24,695,968 D34Y probably damaging Het
Gm2832 G A 14: 41,279,739 M68I Het
Hmgcr A G 13: 96,658,910 S384P probably benign Het
Hsp90aa1 T C 12: 110,694,112 T299A possibly damaging Het
Igsf10 A G 3: 59,331,701 M353T probably benign Het
Ino80b T C 6: 83,122,325 T211A probably benign Het
Lamb2 C A 9: 108,489,488 T1607K probably benign Het
Lhfpl5 A G 17: 28,582,983 E218G probably benign Het
Lrrc3 C T 10: 77,900,991 D204N probably damaging Het
Mavs C A 2: 131,243,131 L160I probably benign Het
Morn4 C T 19: 42,078,044 D35N possibly damaging Het
Mroh8 G A 2: 157,221,263 H813Y probably benign Het
Myf6 T C 10: 107,494,529 E59G probably damaging Het
Nlrp10 T A 7: 108,925,198 E358D possibly damaging Het
Olfr1009 T A 2: 85,721,608 F68I probably damaging Het
Olfr107 T C 17: 37,406,204 F219L probably benign Het
Olfr1120 A G 2: 87,357,722 T93A probably benign Het
Olfr396-ps1 T A 11: 73,928,506 L94* probably null Het
Olfr525 T C 7: 140,322,846 I49T possibly damaging Het
Olfr846 T C 9: 19,361,283 E24G possibly damaging Het
Optn T C 2: 5,052,837 probably null Het
Plxna4 T A 6: 32,192,269 H1331L probably damaging Het
Poli A T 18: 70,516,849 M357K possibly damaging Het
Psd4 T G 2: 24,394,543 C140G possibly damaging Het
Rab3gap1 T A 1: 127,891,098 probably null Het
Rasa3 T C 8: 13,631,826 N41S probably benign Het
Rps6kc1 A G 1: 190,800,210 S532P probably benign Het
S100a3 T A 3: 90,602,440 probably null Het
Sfrp5 T C 19: 42,201,765 K83E possibly damaging Het
Slco1a4 T C 6: 141,834,708 I119V probably benign Het
Snx15 T A 19: 6,120,596 Q271L probably damaging Het
Sorcs2 C A 5: 36,021,261 S1128I probably damaging Het
Tbc1d7 A T 13: 43,154,735 F85I probably damaging Het
Thoc7 A G 14: 13,953,528 Y46H probably damaging Het
Top1mt T A 15: 75,667,448 Y366F probably damaging Het
Trpv2 C A 11: 62,584,461 S233R probably benign Het
Vav1 C A 17: 57,279,268 T24N probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy4 G T 14: 32,964,626 probably null Het
Wdr3 A G 3: 100,154,997 S201P probably benign Het
Wdr34 A G 2: 30,038,266 V116A possibly damaging Het
Wfs1 C T 5: 36,966,950 D866N probably damaging Het
Wnk1 A T 6: 119,965,726 probably benign Het
Xpot G T 10: 121,602,399 Q762K probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Other mutations in Lpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Lpo APN 11 87821138 missense probably benign 0.43
IGL01833:Lpo APN 11 87807333 missense possibly damaging 0.81
IGL02413:Lpo APN 11 87806906 missense possibly damaging 0.87
IGL02706:Lpo APN 11 87817773 missense probably benign 0.02
IGL02865:Lpo APN 11 87806977 missense possibly damaging 0.80
IGL02939:Lpo APN 11 87815178 missense possibly damaging 0.85
R1072:Lpo UTSW 11 87818434 missense probably damaging 1.00
R1169:Lpo UTSW 11 87817317 missense possibly damaging 0.58
R1667:Lpo UTSW 11 87807241 unclassified probably benign
R1719:Lpo UTSW 11 87809192 unclassified probably null
R2133:Lpo UTSW 11 87821130 missense probably benign 0.17
R2871:Lpo UTSW 11 87816524 missense possibly damaging 0.51
R2871:Lpo UTSW 11 87816524 missense possibly damaging 0.51
R4382:Lpo UTSW 11 87822201 missense probably benign 0.14
R4657:Lpo UTSW 11 87814347 missense probably damaging 1.00
R4936:Lpo UTSW 11 87810340 missense probably benign 0.02
R4969:Lpo UTSW 11 87806925 missense probably benign 0.09
R5368:Lpo UTSW 11 87821069 missense possibly damaging 0.61
R5536:Lpo UTSW 11 87816563 missense probably damaging 1.00
R6246:Lpo UTSW 11 87822232 missense unknown
R6556:Lpo UTSW 11 87817763 nonsense probably null
R6817:Lpo UTSW 11 87809241 missense probably benign
R7203:Lpo UTSW 11 87809251 missense possibly damaging 0.75
R7206:Lpo UTSW 11 87807423 missense probably damaging 1.00
RF010:Lpo UTSW 11 87821102 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAATGGCTGAGCACATGAACG -3'
(R):5'- ACATGCTTTCCCAACCTGAC -3'

Sequencing Primer
(F):5'- CTGAGCACATGAACGGATATAAAGC -3'
(R):5'- ATGTGCAGCCCCGTGAAG -3'
Posted On2019-05-13