Incidental Mutation 'R7024:Vmn2r111'
ID545866
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Namevomeronasal 2, receptor 111
SynonymsEG210876
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7024 (G1)
Quality Score202.009
Status Validated
Chromosome17
Chromosomal Location22547941-22573273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22559051 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 549 (N549S)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,220 S128P probably damaging Het
Abcc1 G C 16: 14,413,383 probably null Het
Armc4 A C 18: 7,211,593 D760E probably benign Het
Atg2a G A 19: 6,250,219 G686S possibly damaging Het
Atrnl1 A T 19: 57,638,450 probably null Het
Brd4 T C 17: 32,221,910 probably benign Het
C77080 T A 4: 129,225,408 E173V probably null Het
Camsap3 A G 8: 3,608,242 E688G probably damaging Het
Cc2d2a T A 5: 43,733,929 S1402R probably benign Het
Ccnb1 A G 13: 100,786,380 probably null Het
Cdc42bpb G A 12: 111,326,085 H339Y probably damaging Het
Ciart T A 3: 95,879,080 T94S probably benign Het
Col6a5 T A 9: 105,912,475 K1540* probably null Het
Csmd3 A T 15: 47,710,991 V1969E probably damaging Het
Dgka T G 10: 128,720,487 N710T probably damaging Het
Dock6 A G 9: 21,820,370 V1212A probably benign Het
En1 C T 1: 120,603,322 P97L unknown Het
Esd T A 14: 74,744,662 F172L probably damaging Het
Gfer C A 17: 24,695,968 D34Y probably damaging Het
Gm2832 G A 14: 41,279,739 M68I Het
Hmgcr A G 13: 96,658,910 S384P probably benign Het
Hsp90aa1 T C 12: 110,694,112 T299A possibly damaging Het
Igsf10 A G 3: 59,331,701 M353T probably benign Het
Ino80b T C 6: 83,122,325 T211A probably benign Het
Lamb2 C A 9: 108,489,488 T1607K probably benign Het
Lhfpl5 A G 17: 28,582,983 E218G probably benign Het
Lpo C A 11: 87,816,443 C248F probably damaging Het
Lrrc3 C T 10: 77,900,991 D204N probably damaging Het
Mavs C A 2: 131,243,131 L160I probably benign Het
Morn4 C T 19: 42,078,044 D35N possibly damaging Het
Mroh8 G A 2: 157,221,263 H813Y probably benign Het
Myf6 T C 10: 107,494,529 E59G probably damaging Het
Nlrp10 T A 7: 108,925,198 E358D possibly damaging Het
Olfr1009 T A 2: 85,721,608 F68I probably damaging Het
Olfr107 T C 17: 37,406,204 F219L probably benign Het
Olfr1120 A G 2: 87,357,722 T93A probably benign Het
Olfr396-ps1 T A 11: 73,928,506 L94* probably null Het
Olfr525 T C 7: 140,322,846 I49T possibly damaging Het
Olfr846 T C 9: 19,361,283 E24G possibly damaging Het
Optn T C 2: 5,052,837 probably null Het
Plxna4 T A 6: 32,192,269 H1331L probably damaging Het
Poli A T 18: 70,516,849 M357K possibly damaging Het
Psd4 T G 2: 24,394,543 C140G possibly damaging Het
Rab3gap1 T A 1: 127,891,098 probably null Het
Rasa3 T C 8: 13,631,826 N41S probably benign Het
Rps6kc1 A G 1: 190,800,210 S532P probably benign Het
S100a3 T A 3: 90,602,440 probably null Het
Sfrp5 T C 19: 42,201,765 K83E possibly damaging Het
Slco1a4 T C 6: 141,834,708 I119V probably benign Het
Snx15 T A 19: 6,120,596 Q271L probably damaging Het
Sorcs2 C A 5: 36,021,261 S1128I probably damaging Het
Tbc1d7 A T 13: 43,154,735 F85I probably damaging Het
Thoc7 A G 14: 13,953,528 Y46H probably damaging Het
Top1mt T A 15: 75,667,448 Y366F probably damaging Het
Trpv2 C A 11: 62,584,461 S233R probably benign Het
Vav1 C A 17: 57,279,268 T24N probably damaging Het
Wdfy4 G T 14: 32,964,626 probably null Het
Wdr3 A G 3: 100,154,997 S201P probably benign Het
Wdr34 A G 2: 30,038,266 V116A possibly damaging Het
Wfs1 C T 5: 36,966,950 D866N probably damaging Het
Wnk1 A T 6: 119,965,726 probably benign Het
Xpot G T 10: 121,602,399 Q762K probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22548753 missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22568984 missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22569016 missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22571985 nonsense probably null
IGL01465:Vmn2r111 APN 17 22548737 missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22548572 missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22571392 missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22569073 splice site probably benign
IGL01962:Vmn2r111 APN 17 22548284 missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22570773 missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22568856 missense probably benign
IGL02519:Vmn2r111 APN 17 22548339 missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22571050 missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22573224 missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22559042 critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22571245 missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22570858 missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22548009 missense probably benign
R0064:Vmn2r111 UTSW 17 22572072 missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22573121 missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22571116 missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22571399 missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22548060 missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22548081 missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22548414 missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22559062 missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22573104 missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22559170 splice site probably benign
R3700:Vmn2r111 UTSW 17 22571161 nonsense probably null
R3782:Vmn2r111 UTSW 17 22571320 missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22559115 missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22573178 missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22548656 missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22548041 missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22571143 missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22571020 missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22548102 nonsense probably null
R5398:Vmn2r111 UTSW 17 22573271 start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22548489 missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22548257 missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22548815 missense probably benign 0.00
R6149:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6207:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22573089 missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22571908 missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22548602 missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22571245 missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22548184 missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22548714 missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22571086 missense possibly damaging 0.93
R7514:Vmn2r111 UTSW 17 22548399 missense probably benign 0.05
R7651:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22570733 missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22573102 missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7921:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8117:Vmn2r111 UTSW 17 22571488 missense probably benign 0.12
X0026:Vmn2r111 UTSW 17 22548695 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAAGGTGTAAAAGATGCAGCCC -3'
(R):5'- TCAAGGAGTTGGGAAACAATTCAAC -3'

Sequencing Primer
(F):5'- GGTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'
Posted On2019-05-13