Incidental Mutation 'R7024:Lhfpl5'
ID545868
Institutional Source Beutler Lab
Gene Symbol Lhfpl5
Ensembl Gene ENSMUSG00000062252
Gene Namelipoma HMGIC fusion partner-like 5
SynonymsTmhs, 9330179O15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R7024 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location28575718-28583593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28582983 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 218 (E218G)
Ref Sequence ENSEMBL: ENSMUSP00000079598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080780] [ENSMUST00000130643]
Predicted Effect probably benign
Transcript: ENSMUST00000080780
AA Change: E218G

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000079598
Gene: ENSMUSG00000062252
AA Change: E218G

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 25 202 1.5e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130643
SMART Domains Protein: ENSMUSP00000116259
Gene: ENSMUSG00000004865

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:Pkinase_Tyr 80 229 6.8e-11 PFAM
Pfam:Pkinase 80 231 5.6e-23 PFAM
low complexity region 241 255 N/A INTRINSIC
coiled coil region 264 297 N/A INTRINSIC
Pfam:Pkinase 468 646 3e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in this gene result in deafness in humans, and a mutation in a similar gene in mice results in deafness and vestibular dysfunction with severe degeneration of the organ of Corti. It is proposed to function in hair bundle morphogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in deafness and vestibular dysfunction with severe degeneration of the organ of Corti. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,220 S128P probably damaging Het
Abcc1 G C 16: 14,413,383 probably null Het
Armc4 A C 18: 7,211,593 D760E probably benign Het
Atg2a G A 19: 6,250,219 G686S possibly damaging Het
Atrnl1 A T 19: 57,638,450 probably null Het
Brd4 T C 17: 32,221,910 probably benign Het
C77080 T A 4: 129,225,408 E173V probably null Het
Camsap3 A G 8: 3,608,242 E688G probably damaging Het
Cc2d2a T A 5: 43,733,929 S1402R probably benign Het
Ccnb1 A G 13: 100,786,380 probably null Het
Cdc42bpb G A 12: 111,326,085 H339Y probably damaging Het
Ciart T A 3: 95,879,080 T94S probably benign Het
Col6a5 T A 9: 105,912,475 K1540* probably null Het
Csmd3 A T 15: 47,710,991 V1969E probably damaging Het
Dgka T G 10: 128,720,487 N710T probably damaging Het
Dock6 A G 9: 21,820,370 V1212A probably benign Het
En1 C T 1: 120,603,322 P97L unknown Het
Esd T A 14: 74,744,662 F172L probably damaging Het
Gfer C A 17: 24,695,968 D34Y probably damaging Het
Gm2832 G A 14: 41,279,739 M68I Het
Hmgcr A G 13: 96,658,910 S384P probably benign Het
Hsp90aa1 T C 12: 110,694,112 T299A possibly damaging Het
Igsf10 A G 3: 59,331,701 M353T probably benign Het
Ino80b T C 6: 83,122,325 T211A probably benign Het
Lamb2 C A 9: 108,489,488 T1607K probably benign Het
Lpo C A 11: 87,816,443 C248F probably damaging Het
Lrrc3 C T 10: 77,900,991 D204N probably damaging Het
Mavs C A 2: 131,243,131 L160I probably benign Het
Morn4 C T 19: 42,078,044 D35N possibly damaging Het
Mroh8 G A 2: 157,221,263 H813Y probably benign Het
Myf6 T C 10: 107,494,529 E59G probably damaging Het
Nlrp10 T A 7: 108,925,198 E358D possibly damaging Het
Olfr1009 T A 2: 85,721,608 F68I probably damaging Het
Olfr107 T C 17: 37,406,204 F219L probably benign Het
Olfr1120 A G 2: 87,357,722 T93A probably benign Het
Olfr396-ps1 T A 11: 73,928,506 L94* probably null Het
Olfr525 T C 7: 140,322,846 I49T possibly damaging Het
Olfr846 T C 9: 19,361,283 E24G possibly damaging Het
Optn T C 2: 5,052,837 probably null Het
Plxna4 T A 6: 32,192,269 H1331L probably damaging Het
Poli A T 18: 70,516,849 M357K possibly damaging Het
Psd4 T G 2: 24,394,543 C140G possibly damaging Het
Rab3gap1 T A 1: 127,891,098 probably null Het
Rasa3 T C 8: 13,631,826 N41S probably benign Het
Rps6kc1 A G 1: 190,800,210 S532P probably benign Het
S100a3 T A 3: 90,602,440 probably null Het
Sfrp5 T C 19: 42,201,765 K83E possibly damaging Het
Slco1a4 T C 6: 141,834,708 I119V probably benign Het
Snx15 T A 19: 6,120,596 Q271L probably damaging Het
Sorcs2 C A 5: 36,021,261 S1128I probably damaging Het
Tbc1d7 A T 13: 43,154,735 F85I probably damaging Het
Thoc7 A G 14: 13,953,528 Y46H probably damaging Het
Top1mt T A 15: 75,667,448 Y366F probably damaging Het
Trpv2 C A 11: 62,584,461 S233R probably benign Het
Vav1 C A 17: 57,279,268 T24N probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy4 G T 14: 32,964,626 probably null Het
Wdr3 A G 3: 100,154,997 S201P probably benign Het
Wdr34 A G 2: 30,038,266 V116A possibly damaging Het
Wfs1 C T 5: 36,966,950 D866N probably damaging Het
Wnk1 A T 6: 119,965,726 probably benign Het
Xpot G T 10: 121,602,399 Q762K probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Other mutations in Lhfpl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Lhfpl5 APN 17 28576175 missense possibly damaging 0.49
R0885:Lhfpl5 UTSW 17 28576037 missense probably damaging 1.00
R3176:Lhfpl5 UTSW 17 28579946 missense possibly damaging 0.87
R3276:Lhfpl5 UTSW 17 28579946 missense possibly damaging 0.87
R4747:Lhfpl5 UTSW 17 28579976 missense probably damaging 1.00
R4817:Lhfpl5 UTSW 17 28576326 missense possibly damaging 0.93
R4817:Lhfpl5 UTSW 17 28582988 makesense probably null
R5148:Lhfpl5 UTSW 17 28579968 missense probably damaging 1.00
R5447:Lhfpl5 UTSW 17 28576097 missense probably damaging 1.00
R7605:Lhfpl5 UTSW 17 28576331 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGATGCAGCGATCTTCTAGAAAGTC -3'
(R):5'- GCTCAAAGCATAACAATGGCTC -3'

Sequencing Primer
(F):5'- GCTGGTACAAGACTTTAATTCCAGC -3'
(R):5'- CACAAACAGCTCTGTCTGA -3'
Posted On2019-05-13